Previous Contig 006942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011E18Sequence452006942 (2)692008703 (2)gb:AY062496_15651520.004Arabidopsis thaliana putative protein phosphatase-2C (PP2C) (At3g02750; F13E7.31
JMSF034F21Sequence593006942 (2)gb:AY062496_15651520.001Arabidopsis thaliana putative protein phosphatase-2C (PP2C) (At3g02750; F13E7.31630008703 (2)gb:AY062496_15651520.003Arabidopsis thaliana putative protein phosphatase-2C (PP2C) (At3g02750; F13E7.31

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034F21+ GAATCCGGTGCAAATGCTCCTCCCTCCTGTAATCAAACGAAGAATTCCGAGAC
                      ____________________________________________________________
consensus GAATCCGGTGCAAATGCTCCTCCCTCCTGTAATCAAACGAAGAATTCCGAGAC
 
. : . : . : . : . : . :
JMFF011E18+ CAATAGCAGACATGGGAGAACCC
JMSF034F21+ GCTGCCCTCCTCTTGAAGCTTTTCTTCTTCTGAATCCCAATAGCAGACATGGGAGAACCC
                      ____________________________________________________________
consensus GCTGCCCTCCTCTTGAAGCTTTTCTTCTTCTGAATCCCAATAGCAGACATGGGAGAACCC
 
. : . : . : . : . : . :
JMFF011E18+ GGATGNGGGNTCNTGCTTTCAGAAGAAAAGCAGGACCCCATCCGGAGGGCCCTCAATATA
JMSF034F21+ GGATGCGGGCTCCTGCTTTCAGAAGAAAAGCAGGACCCCATCCGGAGGGCCCTCAATATA
                      ____________________________________________________________
consensus GGATGCGGGCTCCTGCTTTCAGAAGAAAAGCAGGACCCCATCCGGAGGGCCCTCAATATA
 
. : . : . : . : . : . :
JMFF011E18+ TTCGATAAGCAATCCAGAACAGATAAACAATCACAACCCCTATTTTCCGTATTTGCCTCC
JMSF034F21+ TTCGATAAGCAATCCAGAACAGATAAACAATCACAACCCCTATTTTCCGTATTTGCCTCC
                      ____________________________________________________________
consensus TTCGATAAGCAATCCAGAACAGATAAACAATCACAACCCCTATTTTCCGTATTTGCCTCC
 
. : . : . : . : . : . :
JMFF011E18+ GTCACAGCCCTCCTAATAATACCCTCTCTGAGCTCTTCAGACCACTTTCCCCAATCCAAT
JMSF034F21+ GTCACAGCCCTCCTAATAATACCCTCTCTGAGCTCTTCAGACCACTTTCCCCAATCCAAT
                      ____________________________________________________________
consensus GTCACAGCCCTCCTAATAATACCCTCTCTGAGCTCTTCAGACCACTTTCCCCAATCCAAT
 
. : . : . : . : . : . :
JMFF011E18+ CAAATCACCCTTGCATCCACTGCCAAATCCAATAAACTTCAACTAGGAAACAGCACAATA
JMSF034F21+ CAAATCACCCTTGCATCCACTGCCAAATCCAATAAACTTCAACTAGGAAACAGCACAATA
                      ____________________________________________________________
consensus CAAATCACCCTTGCATCCACTGCCAAATCCAATAAACTTCAACTAGGAAACAGCACAATA
 
. : . : . : . : . : . :
JMFF011E18+ ATCCAATCCCCCAAATTTGTTTCAGCCTCAAAAGGCAACTAACTTTTAATACCACACCCG
JMSF034F21+ ATCCAATCCCCCAAATTTGTTTCAGCCTCAAAAGGCAACTAACTTTTAATACCACACCCG
                      ____________________________________________________________
consensus ATCCAATCCCCCAAATTTGTTTCAGCCTCAAAAGGCAACTAACTTTTAATACCACACCCG
 
. : . : . : . : . : . :
JMFF011E18+ CCTGTCTTTTTCCTGCAAAAACAGACAAGTTAACGGGAAGATGAACGAACAAAACGGGCA
JMSF034F21+ CCTGTCTTTTTCCTGCAAAAACAGACAAGTTAACGGGAAGATGAACGAACAAAACGGGCA
                      ____________________________________________________________
consensus CCTGTCTTTTTCCTGCAAAAACAGACAAGTTAACGGGAAGATGAACGAACAAAACGGGCA
 
. : . : . : . : . : . :
JMFF011E18+ GAGAGAAACGAGGAGAGGATTGAGATTTGCAAAAGAATCGCCGATAGGACTTATTACAAG
JMSF034F21+ GAGAGAAACGAGGAGAGGATTGAGATTTGCAAAAGAATCGCCGATAGGACTTATTACAAG
                      ____________________________________________________________
consensus GAGAGAAACGAGGAGAGGATTGAGATTTGCAAAAGAATCGCCGATAGGACTTATTACAAG
 
. : . : . : . : . : . :
JMFF011E18+ TTTGGCAAT
JMSF034F21+ TTTGGCAATAAATGTAGCACTACATCCATGAATGTGTATAAGATACGTATGTATGTTGTC
                      ____________________________________________________________
consensus TTTGGCAATAAATGTAGCACTACATCCATGAATGTGTATAAGATACGTATGTATGTTGTC