Previous Contig 006941:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003F08Sequence330006941 (3)751011256 (3)
JMSF034F20Sequence670006941 (3)708011256 (3)
JMSF037D06Sequence657006941 (3)721011256 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037D06+ TCTTTAAATATTTGGCCA
JMSF034F20+ TTAAATATTNGGCCA
                      ____________________________________________________________
consensus TCTTTAAATATTTGGCCA
 
. : . : . : . : . : . :
JMSF037D06+ CTCCAGAAGAGATTATGATATCTCCTTTGCATTTTTCAAATGCGAAGTCGATGGCTTTAC
JMSF034F20+ CACCAGAAGAGATTATGATATCTCCTTGGCATTTTTCAAATGCGAAGTCGATGGCTTTAC
                      ____________________________________________________________
consensus CTCCAGAAGAGATTATGATATCTCCTTTGCATTTTTCAAATGCGAAGTCGATGGCTTTAC
 
. : . : . : . : . : . :
JMSF037D06+ CGATTTCATGGAATCCCTTATATGAGAATTGTTCATGTCTCGGAGATGTTTTAATTTCTT
JMSF034F20+ CGATTTCATGGAATCCCTTATATGAGAATTGTTCATGTCTCGGAGATG--TTAATTTCTT
                      ____________________________________________________________
consensus CGATTTCATGGAATCCCTTATATGAGAATTGTTCATGTCTCGGAGATGTTTTAATTTCTT
 
. : . : . : . : . : . :
JMSF037D06+ CACATGTTAAGTATACTCCCGCTTTGGGACCAGTATACAGAACATAAAAAGTGAATGGTT
JMSF034F20+ CACATGTTAAGTATACTCCCGCTTTGGGACCAGTATACAAAACATAAAAAGTGTTTGGTT
                      ____________________________________________________________
consensus CACATGTTAAGTATACTCCCGCTTTGGGACCAGTATACAGAACATAAAAAGTGTTTGGTT
 
. : . : . : . : . : . :
JMSF037D06+ TCTTAGTCAAATGATTGTCCCCCATGAGAGTAGCTTACAAGAGCATTGATGCATGCTCCT
JMSF034F20+ TC-TAGTCAAATGATTGTCCCCCATGAAAGTAGCTTACAAGAGCATTGATGCATGCTCCT
                      ____________________________________________________________
consensus TCTTAGTCAAATGATTGTCCCCCATGAGAGTAGCTTACAAGAGCATTGATGCATGCTCCT
 
. : . : . : . : . : . :
JMSF037D06+ TGATAGCATTTGCCTGGGGAGTAGTGGACAATTTTCTTGAATTGTCAATAATACATTGCT
JMSF034F20+ TGATAGCATTTGCCTGGGGAGTAGTGGACAATTTTCTTGAATTGTCAATAATACATTGCT
                      ____________________________________________________________
consensus TGATAGCATTTGCCTGGGGAGTAGTGGACAATTTTCTTGAATTGTCAATAATACATTGCT
 
. : . : . : . : . : . :
JMSF037D06+ CCTCTTTTTGGAGTTTTTCCTTTAGAGGAGTTTTGAAGTGATAATTTTCAGGTGATGTCT
JMSF034F20+ CCTCTTTTTGGAGTTTTTCCTTTAGAGGAGTTTTGAATTGATAATTTTCAGGTGATGTCT
                      ____________________________________________________________
consensus CCTCTTTTTGGAGTTTTTCCTTTAGAGGAGTTTTGAATTGATAATTTTCAGGTGATGTCT
 
. : . : . : . : . : . :
JMSF037D06+ TCAATTTTGTTTTGTCAAACCTGAATGTTTTTGCCATGATCCAATG-TGTTTAGTCTTCC
JMSF034F20+ TCAATTTTGTTTTGTCAAACCTGAATGTTTTTGCCATGATCCAATGTTGTTTAGTCTTCC
                      ____________________________________________________________
consensus TCAATTTTGTTTTGTCAAACCTGAATGTTTTTGCCATGATCCAATGTTGTTTAGTCTTCC
 
. : . : . : . : . : . :
JMSF003F08+ CTGAAGTGGAAGGCTTCAAAG
JMSF037D06+ AATTGTGATAAATGTCTGAAATTTGATGTTTGAAGCTTCCTGAAGTGGAAGGCTTCAAAG
JMSF034F20+ AATTGTGATAAATGTCTGAAATTTGATGTTTGAAGCTTCCTGAAGTGGAAGGCTTCCAAG
                      ____________________________________________________________
consensus AATTGTGATAAATGTCTGAAATTTGATGTTTGAAGCTTCCTGAAGTGGAAGGCTTCAAAG
 
. : . : . : . : . : . :
JMSF003F08+ TCTGAAGTTTTGAATGAAATTTAAGTCCGAAGACTTTGAATCCCACCCACCTCGTACTCC
JMSF037D06+ TCTGAAGTTTTGAATGAAATTTAAGTCCGAAGACTTTGAATCCCACCCACCTCGTACTCC
JMSF034F20+ TCTGAAGTTTTGAATGAAATTTAAGTCCGAAGACTTTGAATCCCACCCACCTCGTACTCC
                      ____________________________________________________________
consensus TCTGAAGTTTTGAATGAAATTTAAGTCCGAAGACTTTGAATCCCACCCACCTCGTACTCC
 
. : . : . : . : . : . :
JMSF003F08+ CTCCTTAATATCATATTCGATCTAAATTTACTTGGAAGAAAAGTTGACGTTAAAGAAAGG
JMSF037D06+ CTCCTTAATATCATATTCGATCTAAATTTACTTGGAAGAAAAGTTGACGTTAAAGAAAGG
JMSF034F20+ CTCCTTAATATCATATTCGATCTAAATTTAC-TGGAAAAAAAGTTGACGTTAAAGTAAGG
                      ____________________________________________________________
consensus CTCCTTAATATCATATTCGATCTAAATTTACTTGGAAGAAAAGTTGACGTTAAAGAAAGG
 
. : . : . : . : . : . :
JMSF003F08+ AATTTCTCTTTCAAAACTCAAAGTTCTTTTTTGTAAC
JMSF037D06+ AATTTCTCTTTCAAAACTCAAAGTTCTTTTTTGTAACTC
JMSF034F20+ AATTTGTCTTTCAAACCTCAAAGCT-TTTTTTGTAACTCAAACTATGGTTGTGCCTTTCT
                      ____________________________________________________________
consensus AATTTCTCTTTCAAAACTCAAAGTTCTTTTTTGTAACTCAAACTATGGTTGTGCCTTTCT