Previous Contig 006940:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005N01Sequence396006940 (2)pir|JE0369|JE03693e-05histidine acid phosphatase (EC 3.1.3.-) - Arabidopsis thaliana
JMSF034F18Sequence679006940 (2)pir|JE0369|JE03698e-05histidine acid phosphatase (EC 3.1.3.-) - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034F18+ AAAAAAAAAAAAAAACGTG
                      ____________________________________________________________
consensus AAAAAAAAAAAAAAACGTG
 
. : . : . : . : . : . :
JMSF034F18+ GCACATTCATAACAAAATTAGCCAATCATATTGAACTGTTGTCCAGTCAGCACTGCCAAC
                      ____________________________________________________________
consensus GCACATTCATAACAAAATTAGCCAATCATATTGAACTGTTGTCCAGTCAGCACTGCCAAC
 
. : . : . : . : . : . :
JMSF034F18+ TCATCTGAGGCTTACCTTCCTAGGCAAGTCAGGACTTATGATACTAATTGCCACTTGAGT
                      ____________________________________________________________
consensus TCATCTGAGGCTTACCTTCCTAGGCAAGTCAGGACTTATGATACTAATTGCCACTTGAGT
 
. : . : . : . : . : . :
JMSF034F18+ TCATGTAGGCGAATCAGTGCGTGCAATAAATATGTACCATGAATTGCTGCACTATAAGCA
                      ____________________________________________________________
consensus TCATGTAGGCGAATCAGTGCGTGCAATAAATATGTACCATGAATTGCTGCACTATAAGCA
 
. : . : . : . : . : . :
JMSF034F18+ GAATAACAACTATTGTATCAACTTACTGCAATATATGGTCACCAATGAAATTATTTATCC
                      ____________________________________________________________
consensus GAATAACAACTATTGTATCAACTTACTGCAATATATGGTCACCAATGAAATTATTTATCC
 
. : . : . : . : . : . :
JMSF034F18+ TAGACATCAGCACAATCTGAACAACTGAACAAGGATCATATGAACTTAGAAATTAAATTC
                      ____________________________________________________________
consensus TAGACATCAGCACAATCTGAACAACTGAACAAGGATCATATGAACTTAGAAATTAAATTC
 
. : . : . : . : . : . :
JMSF034F18+ TATAGTCACAGACTCACAGAAAGTAGTTATCATTTTAACACAAGCATGACCTTAAGATAT
                      ____________________________________________________________
consensus TATAGTCACAGACTCACAGAAAGTAGTTATCATTTTAACACAAGCATGACCTTAAGATAT
 
. : . : . : . : . : . :
JMSF005N01+ CCAATAGGTTTAT
JMSF034F18+ ATTACTCCGTACATCTATGCATAAAATAAGAATGCATTTCAAAATTACCAATAGGTTTAT
                      ____________________________________________________________
consensus ATTACTCCGTACATCTATGCATAAAATAAGAATGCATTTCAAAATTACCAATAGGTTTAT
 
. : . : . : . : . : . :
JMSF005N01+ GTGTATTGGGGTACATTGATCGGGAATCTCCGGAGCTATAATCGATTCTTCTGATAGTAT
JMSF034F18+ GTGTATTGGGGTACATTGATCGGGAATCTCCGGAGCTATAATCGATTCTTCTGATAGTAT
                      ____________________________________________________________
consensus GTGTATTGGGGTACATTGATCGGGAATCTCCGGAGCTATAATCGATTCTTCTGATAGTAT
 
. : . : . : . : . : . :
JMSF005N01+ ATCTTTCACAATACCATACCTAGATACAGTACAGAGATGTTTCCGAACATCGAAAACTCC
JMSF034F18+ ATCTTTCACAATACCATACCTAGATACAGTACAGAGATGTTTCCGAACATCGAAAACTCC
                      ____________________________________________________________
consensus ATCTTTCACAATACCATACCTAGATACAGTACAGAGATGTTTCCGAACATCGAAAACTCC
 
. : . : . : . : . : . :
JMSF005N01+ TTCAGCGCTTGAATATAGGGTAAATTCACTGAGAAAAATTACAAATAAAACTGCGACTTC
JMSF034F18+ TTCAGCGCTTGAATATAGGGTAAATTCACTGAGAAAAATTACAAATAAAACTGCGACTTC
                      ____________________________________________________________
consensus TTCAGCGCTTGAATATAGGGTAAATTCACTGAGAAAAATTACAAATAAAACTGCGACTTC
 
. : . : . : . : . : . :
JMSF005N01+ CACGGCCTTCTTCATCTCTCCTCTCTAATTCT
JMSF034F18+ CACGGCCTTCTTCATCTCTCCTCTCTAATTCTGGAATTACCGAATCTACGGCAACTTTTC
                      ____________________________________________________________
consensus CACGGCCTTCTTCATCTCTCCTCTCTAATTCTGGAATTACCGAATCTACGGCAACTTTTC