Previous Contig 006935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038L09Sequence487006935 (8)gb:AY087687_15727152e-24Arabidopsis thaliana clone 37668 mRNA, complete sequence.753006935 (8)gb:AY087687_15727152e-72Arabidopsis thaliana clone 37668 mRNA, complete sequence.
JMFS065B04Sequence615006935 (8)gb:AY087687_15727151e-53Arabidopsis thaliana clone 37668 mRNA, complete sequence.
JMSF034E04Sequence618006935 (8)gb:AY087687_15727152e-48Arabidopsis thaliana clone 37668 mRNA, complete sequence.773006935 (8)gb:AY087687_15727152e-79Arabidopsis thaliana clone 37668 mRNA, complete sequence.
JMSF037B11Sequence616006935 (8)gb:AY087687_15727154e-49Arabidopsis thaliana clone 37668 mRNA, complete sequence.737023743gb:AP003284_18272341e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF049C11Sequence697006935 (8)gb:AY054607_15632616e-64Arabidopsis thaliana Unknown protein (MED24.18) mRNA, complete cds.>gb:AY081486_769006935 (8)pir|T48415|T484155e-79hypothetical protein F8F6.90 - Arabidopsis thaliana>gb:AB005235_1509370 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038L09- CTTTCTTGTTCTATTATTTCTGCAGAAATCATAAG
rJMSF049C11- TAAG
                      ____________________________________________________________
consensus CTTTCTTGTTCTATTATTTCTGCAGAAATCATAAG
 
. : . : . : . : . : . :
rJMFF038L09- ATCACT-GTTGGTTTATACTATATAAGTCCCCAAATTCTTTATGGACACAATTTTTCCAG
rJMSF049C11- ATCACTGGTTGGTTTATACTATATAAGTCCCCAAATTCTTTATGGACACAATTTTTCCAG
rJMSF034E04- AAATTCTTTATGGACACAATTTTTCCAG
                      ____________________________________________________________
consensus ATCACTGGTTGGTTTATACTATATAAGTCCCCAAATTCTTTATGGACACAATTTTTCCAG
 
. : . : . : . : . : . :
rJMFF038L09- TGAAATGCAAGTTCAAGCATCCCCTCCTATGTGAATCAGAAAGTGTAGGTGTTGCTTCAG
rJMSF049C11- TGAAATGCAAGTTCAAGCATCCCCTCCTATGTGAATCAGAAAGTGTAGGTGTTGCTTCAG
rJMSF034E04- TGAAATGCAAGTTCAAGCATCCCCTCCTATGTGAATCAGAAAGTGTAGGTGTTGCTTCAG
                      ____________________________________________________________
consensus TGAAATGCAAGTTCAAGCATCCCCTCCTATGTGAATCAGAAAGTGTAGGTGTTGCTTCAG
 
. : . : . : . : . : . :
rJMFF038L09- AGATAAACCAGATAGAGCAAAATATTATACAGCAGTAGTGGCTTGGAGAAATCAAAACAG
rJMSF049C11- AGATAAACCAGATAGAGCAAAATATTATACAGCAGTAGTGGCTTGGAGAAATCAAAACAG
rJMSF034E04- AGATAAACCAGATAGAGCAAAATATTATACAGCAGTAGTGGCTTGGAGAAATCAAAACAG
                      ____________________________________________________________
consensus AGATAAACCAGATAGAGCAAAATATTATACAGCAGTAGTGGCTTGGAGAAATCAAAACAG
 
. : . : . : . : . : . :
rJMFF038L09- GAAAAGATTACAGCAAGCCTAACTCGTTAGAGAGCGTAAGTTGCCCGTAAATATTCCACA
rJMSF049C11- GAAAAGATTACAGCAAGCCTAACTCGTTAGAGAGCGTAAGTTGCCCGTAAATATTCCACA
rJMSF034E04- GAAAAGATTACAGCAAGCCTAACTCGTTAGAGAGCGTAAGTTGCCCGTAAATATTCCACA
                      ____________________________________________________________
consensus GAAAAGATTACAGCAAGCCTAACTCGTTAGAGAGCGTAAGTTGCCCGTAAATATTCCACA
 
. : . : . : . : . : . :
rJMFF038L09- ATCTCTGCGCTCTCAAACATCTGCACCCCGGTATTTGGATCTTCTAAGTATGGAGCCTGG
rJMSF049C11- ATCTCTGCGCTCTCAAACATCTGCACCCCGGTATTTGGATCTTCTAAGTATGGAGCCTGG
rJMSF034E04- ATCTCTGCGCTCTCAAACATCTGCACCCCGGTATTTGGATCTTCTAAGTATGGAGCCTGG
                      ____________________________________________________________
consensus ATCTCTGCGCTCTCAAACATCTGCACCCCGGTATTTGGATCTTCTAAGTATGGAGCCTGG
 
. : . : . : . : . : . :
rJMFF038L09- AAATGTCCGACTCTCTGGTACAATGACTGGCGTTTGGGGCTGCCACGAGCACAGCTGTGA
rJMSF049C11- AAATGTCCGACTCTCTGGTACAATGACTGGCGTTTGGGGCTGCCACGAGCACAGCTGTGA
rJMSF034E04- AAATGTCCGACTCTCTGGTACAATGACTGGCGTTTGGGGCTGCCACGAGCACAGCTGTGA
                      ____________________________________________________________
consensus AAATGTCCGACTCTCTGGTACAATGACTGGCGTTTGGGGCTGCCACGAGCACAGCTGTGA
 
. : . : . : . : . : . :
rJMFF038L09- AGTATGTGAGGCAGCTCTAGTTCAACAAGTACTTCACGCACAATTTTACAAAACGGAGAA
rJMSF049C11- AGTATGTGAGGCAGCTCTAGTTCAACAAGTACTTCACGCACAATTTTACAAAACGGAGAA
rJMSF034E04- AGTATGTGAGGCAGCTCTAGTTCAACAAGTACTTCACGCACAATTTTACAAAACGGAGAA
                      ____________________________________________________________
consensus AGTATGTGAGGCAGCTCTAGTTCAACAAGTACTTCACGCACAATTTTACAAAACGGAGAA
 
. : . : . : . : . : . :
rJMFF038L09- GGCTCATATGCCCATATCTCTAGAGGCTTTGGTGGAAGTTTAGATGGAGTATAGGACGAT
rJMSF049C11- GGCTCATATGCCCATATCTCTAGAGGCTTTGGTGGAAGTTTAGATGGAGTATAGGACGAT
rJMSF034E04- GGCTCATATGCCCATATCTCTAGAGGCTTTGGTGGAAGTTTAGATGGAGTATAGGACGAT
                      ____________________________________________________________
consensus GGCTCATATGCCCATATCTCTAGAGGCTTTGGTGGAAGTTTAGATGGAGTATAGGACGAT
 
. : . : . : . : . : . :
rJMFF038L09- CCCTTTCCCATTCTACCAATCATAGCAAAGCCTTCTGTCAAAGTAGTTAGCAGACCGAGA
rJMSF049C11- CCCTTTCCCATTCTACCAATCATAGCAAAGCCTTCTGTCAAAGTAGTTAGCAGACCGAGA
rJMSF034E04- CCCTTTCCCATTCTACCAATCATAGCAAAGCCTTCTGTCAAAGTAGTTAGCAGACCGAGA
                      ____________________________________________________________
consensus CCCTTTCCCATTCTACCAATCATAGCAAAGCCTTCTGTCAAAGTAGTTAGCAGACCGAGA
 
. : . : . : . : . : . :
rJMFF038L09- GACAATAAAAGTGGGACCTGTCCATCACCATATTTTCCAACCAGGTACTTTATTATCTCA
rJMSF049C11- GACAATAAAAGTGGGACCTGTCCATCACCATATTTTCCAACCAGGTACTTTATTATCTCA
rJMSF034E04- GACAATAAAAGTGGGACCTGTCCATCGCCATATTTTCCAACCAGGTACTTTATTATCTCA
                      ____________________________________________________________
consensus GACAATAAAAGTGGGACCTGTCCATCACCATATTTTCCAACCAGGTACTTTATTATCTCA
 
. : . : . : . : . : . :
rJMFF038L09- TCTGATTCATACATTGCAACTCCAGTGTTTGGATCAACCATATAAGGAAACTGTTGCTTT
rJMSF049C11- TCTGATTCATACATTGCAACTCCAGTGTTTGGATCAACCATATAAGGAAACTGTTGCTTT
rJMSF034E04- TCTGATTCATACATTGCAACTCCAGTGTTTGGATCAACCATATAAGGAAACTGTTGCTTT
JMSF049C11+ AGTGTTTGGATCAACCATATAAGGAAACTGTTGCTTT
                      ____________________________________________________________
consensus TCTGATTCATACATTGCAACTCCAGTGTTTGGATCAACCATATAAGGAAACTGTTGCTTT
 
. : . : . : . : . : . :
rJMFF038L09- CCACCCATCTGAGCAACCTTANGACGAAAGTTTGGGCCATTTCTTGGGCAAGGATAGAA
rJMSF049C11- CCACCCATCTGAGCAACCTTAGGACGAAAGTTTGGGCCATTTCTTGGGCAAGGATAGAAC
rJMSF034E04- CCACCCATCTGAGCAACCTTAGGACGAAAGTTTGGGCCATTTCTTGGGCAAGGATAGAAC
JMSF037B11+ TTCTTGGGCAAGGATAGAAC
JMFS065B04+ GAGCAACCTTAGGACGAAAGTTTGGGCCATNTCTTGGGCAAGGATAGAAC
JMSF049C11+ CCACCCATCTGAGCAACCTTAGGACGAAAGTTTGGGCCATTTCTTGGGCAAGGATAGAAC
JMSF034E04+ CTTGGGCAAGGATAGAAC
                      ____________________________________________________________
consensus CCACCCATCTGAGCAACCTTAGGACGAAAGTTTGGGCCATTTCTTGGGCAAGGATAGAAC
 
. : . : . : . : . : . :
rJMSF049C11- AAGACATCAAGATCCAAAATTGCGACAATTTCCC
rJMSF034E04- AAGACATCANGATCCAAAATTGCGACAATTT-CCTTACCTTCCGAC-AAAGGGGCAGCTT
JMSF037B11+ AAGACATCAAGATCCAAAATTGCGACAATTTCCCTTACCTTCCGACAAAAGGGGCAGCTT
JMFS065B04+ AAGACATCAAGATCCAAAATTGCGACAATTTCCCTTACCTTCCGACAAAAGGGGCAGCTT
JMSF049C11+ AAGACATCAAGATCCAAAATTGCGACAATTTCCCTTACCTTCCGACAAAAGGGGCAGCTT
JMSF034E04+ AAGACATCAAGATCCAAAATTGCGACAATTTCCCTTACCTTCCGACAAAAGGGGCAGCTT
                      ____________________________________________________________
consensus AAGACATCAAGATCCAAAATTGCGACAATTTCCCTTACCTTCCGACAAAAGGGGCAGCTT
 
. : . : . : . : . : . :
rJMSF034E04- TC-AATTCATATATCTGA
JMFF038L09+ GAAGTCTCTTTC
JMSF037B11+ TCAAATTCATATATCTGAATTGGCTTCTCAGGCCGAGGACCCAGTTTCGAAGTCTCTTTC
JMFS065B04+ TCAAATTCATATATCTGAATTGGCTTCTCAGGCCGAGGACCCAGTTTCGAAGTCTCTTTC
JMSF049C11+ TCAAATTCATATATCTGAATTGGCTTCTCAGGCCGAGGACCCAGTTTCGAAGTCTCTTTC
JMSF034E04+ TCAAATTCATATATCTGAATTGGCTTCTCAGGCCGAGGACCCAGTTTCGAAGTCTCTTTC
                      ____________________________________________________________
consensus TCAAATTCATATATCTGAATTGGCTTCTCAGGCCGAGGACCCAGTTTCGAAGTCTCTTTC
 
. : . : . : . : . : . :
JMFF038L09+ ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
JMSF037B11+ ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
JMFS065B04+ ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
JMSF049C11+ ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
JMSF034E04+ ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
                      ____________________________________________________________
consensus ACCGCGAAACCAGCAATTTGAAGTGCATACTGGTCAGGTGGTATCTCTTTCTTGTCCACA
 
. : . : . : . : . : . :
JMFF038L09+ AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
JMSF037B11+ AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
JMFS065B04+ AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
JMSF049C11+ AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
JMSF034E04+ AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
                      ____________________________________________________________
consensus AAGGAGGCTGAATATCCAGAAACTAGAGCAGCAGTGCCGAGTCGAAACAATAGCGCGAGA
 
. : . : . : . : . : . :
JMFF038L09+ GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
JMSF037B11+ GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
JMFS065B04+ GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
JMSF049C11+ GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
JMSF034E04+ GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
                      ____________________________________________________________
consensus GAAGCTCCCAATATGTCCAAGAACTTATCACCCCTCACGTTGAAAGGCTTGGGCTGCGGC
 
. : . : . : . : . : . :
JMFF038L09+ GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
JMSF037B11+ GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
JMFS065B04+ GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
JMSF049C11+ GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
JMSF034E04+ GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
                      ____________________________________________________________
consensus GCCTTGAAATTGGGCGGCGCAGAAAACGAAGCCCCCGATTTGGGTCCCTCTTTCGTGCTG
 
. : . : . : . : . : . :
JMFF038L09+ ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
JMSF037B11+ ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
JMFS065B04+ ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
JMSF049C11+ ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
JMSF034E04+ ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
                      ____________________________________________________________
consensus ACGGAAGCAGAAACCGTGGGGTTTTCCGAAGATGCTCTAACGATAAAGACTCTGTTGCTC
 
. : . : . : . : . : . :
JMFF038L09+ CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
JMSF037B11+ CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
JMFS065B04+ CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
JMSF049C11+ CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
JMSF034E04+ CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
                      ____________________________________________________________
consensus CAAGAGTTGGATACTGCTGCTTTCCGGGTCGAAAGTGGTCCCGCAACTGGGGTCGCTACA
 
. : . : . : . : . : . :
JMFF038L09+ AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGTGGA
JMSF037B11+ AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGTGGA
JMFS065B04+ AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGT-GA
JMSF049C11+ AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGTGGA
JMSF034E04+ AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGTGGA
                      ____________________________________________________________
consensus AAGTTCAGAGCTCCGTACATGGCTACCTCTCCGGGGAAGCTCCGGACGGAAACGGGTGGA
 
. : . : . : . : . : . :
JMFF038L09+ AATTCCGGCGGTGTACGGTGCGTGTGTAATGTGTTGGTGTGGCCAACAATGCAAC
JMSF037B11+ AATTCCGGCGGTGTACGGTGCGTGTGTAATGTGTTGGTGTGGCCAACAATGCAAC
JMFS065B04+ AATTCCGGCGGTGTACGGTGCGTGTG
JMSF049C11+ AATTCCGGCGGTGTACGGTGCGTGTGTAATGTGTTGGTGTGGCCAACAATGCAAC
JMSF034E04+ AATTCCGGCGGTGTACGGTGAGTGTGTAATGTGTTGGTGTGGCCAACAATGCAACAGGTC
                      ____________________________________________________________
consensus AATTCCGGCGGTGTACGGTGCGTGTGTAATGTGTTGGTGTGGCCAACAATGCAACAGGTC