Previous Contig 006934:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111D05Sequence627006934 (2)gb:NTA294474_16913112e-19Nicotiana tabacum mRNA for SET-domain-containing protein (set1 gene).
JMSF034D24Sequence634006934 (2)gb:NTA294474_16913112e-12Nicotiana tabacum mRNA for SET-domain-containing protein (set1 gene).559023609gb:NTA294474_16913111e-32Nicotiana tabacum mRNA for SET-domain-containing protein (set1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111D05+ TGAGTTCAAAGGAACAGGGGAAA
                      ____________________________________________________________
consensus TGAGTTCAAAGGAACAGGGGAAA
 
. : . : . : . : . : . :
JMFS111D05+ TAGGCTGAGTAAAACCAAATGGAGTTTGCTCAGTTTGTCTACCCGAGTCATTTGGAGCCA
JMSF034D24+ TGCTCAGTTTGTCTACCCGAGTCATTTGGAGCCA
                      ____________________________________________________________
consensus TAGGCTGAGTAAAACCAAATGGAGTTTGCTCAGTTTGTCTACCCGAGTCATTTGGAGCCA
 
. : . : . : . : . : . :
JMFS111D05+ GAAATGGGTAAAAAGGAGCAACTCCAGGAGGGAAAGGACCAGATGGAGGAACACAAGTAA
JMSF034D24+ GAAATGGGTAAAAAGGAGCAACTCCAGGAGGGAAAGGACCAGATGGAGGAACACANGTAA
                      ____________________________________________________________
consensus GAAATGGGTAAAAAGGAGCAACTCCAGGAGGGAAAGGACCAGATGGAGGAACACAAGTAA
 
. : . : . : . : . : . :
JMFS111D05+ AGGGTGAAGGTTGGGGAGCACCGCTTGCTGACATCCCATTTGCAGATGGAAATACTGGAA
JMSF034D24+ AGGGTGAAGGTTGGGGAGCACCGCTTGCTGACATCCCATTTGCAGATGGAAATACTGGAA
                      ____________________________________________________________
consensus AGGGTGAAGGTTGGGGAGCACCGCTTGCTGACATCCCATTTGCAGATGGAAATACTGGAA
 
. : . : . : . : . : . :
JMFS111D05+ CTAAACATCTCATGGGCTTTATATCCAAGATCCTAGACTTATCAATAGGCTCAGCTGCTG
JMSF034D24+ CTAAACATCTCATGGGCTTTATATCCANGATCCTAGACTTATCAATAGGCTCAGCTGCTG
                      ____________________________________________________________
consensus CTAAACATCTCATGGGCTTTATATCCAAGATCCTAGACTTATCAATAGGCTCAGCTGCTG
 
. : . : . : . : . : . :
JMFS111D05+ GAACTGAGTTTGATGTTGTACCTTGCTCCATTACACCAAAAACCCAATCCAGAAACAAAA
JMSF034D24+ GAACTGAGTTTGATGTTGTACCTTGCTCCATTACACCAAAAACCCANTCCAGAAACAAAA
                      ____________________________________________________________
consensus GAACTGAGTTTGATGTTGTACCTTGCTCCATTACACCAAAAACCCAATCCAGAAACAAAA
 
. : . : . : . : . : . :
JMFS111D05+ GTCACAAACTTTGCTCCAATAAGTCCCCAAAACACTAACTTCCACCCTTTTTAAACTTCT
JMSF034D24+ GTCACANACTTTGCTCCAATAAGTCCCCAAAACACTAACTTCCACCCTTTTTAAACTTCT
                      ____________________________________________________________
consensus GTCACAAACTTTGCTCCAATAAGTCCCCAAAACACTAACTTCCACCCTTTTTAAACTTCT
 
. : . : . : . : . : . :
JMFS111D05+ AATTGCTATGCAGAACAACAGATGTACAGCCACAGATCTTGTTGGAAGAACAAAATGTTT
JMSF034D24+ AATTGCTATGCAGAACAACAGATGTACANCCACAGATCTTGTTGGAAGAACAAAATGTTT
                      ____________________________________________________________
consensus AATTGCTATGCAGAACAACAGATGTACAGCCACAGATCTTGTTGGAAGAACAAAATGTTT
 
. : . : . : . : . : . :
JMFS111D05+ TTTTATTAGAATGTGCAGCAAAAGACCAAATGTGACCCAAGTGGAGATTGAAGACGACCT
JMSF034D24+ TTTTATTAGAATGTGCAGCAAAAGACCAAATGTGACCCANGTGGAGATTGAAGACGACCT
                      ____________________________________________________________
consensus TTTTATTAGAATGTGCAGCAAAAGACCAAATGTGACCCAAGTGGAGATTGAAGACGACCT
 
. : . : . : . : . : . :
JMFS111D05+ TTTATCATATCAGAGCGGTAGCAAACACAGAAGAGCAAGTGAGAATAAATAAAGCCGGCA
JMSF034D24+ TTTATCATATCNGAGCGGTAGCANACACAGAAGAGCAAGTGAGAATAAATAAAGCCGGCA
                      ____________________________________________________________
consensus TTTATCATATCAGAGCGGTAGCAAACACAGAAGAGCAAGTGAGAATAAATAAAGCCGGCA
 
. : . : . : . : . : . :
JMFS111D05+ TCTCCTTGGTTCTCTGTGTTCTGAGGATTTGAGAGCGAAGTGAGAATACAGAGAGAGAGA
JMSF034D24+ TCTCCTTGGTTCTCTGTGTTCTGAGGATTTGAGAGCGAAGTGAGAATACAGAGAGAGAGA
                      ____________________________________________________________
consensus TCTCCTTGGTTCTCTGTGTTCTGAGGATTTGAGAGCGAAGTGAGAATACAGAGAGAGAGA
 
. : . : . : . : . : . :
JMFS111D05+ GAGA
JMSF034D24+ GAGAGAGAGAGAGAGAGAGAGATCAAGGAGAGGTGTGTTCCTTTGAAATTGACGGGTTTC
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAGAGAGATCAAGGAGAGGTGTGTTCCTTTGAAATTGACGGGTTTC