Previous Contig 006933:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009C23Sequence536006933 (3)gb:AB023038_15154138e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562785008592 (3)gb:AB023038_15154126e-50Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:BT001008_1635
JMSF034D22Sequence669006933 (3)gb:AB023038_15154132e-51Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562674008592 (3)gb:AB023038_15154125e-62Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:BT001008_1635
JMSF041J08Sequence683006933 (3)gb:AF465265_18021115e-55Zea mays cytochrome P450 monooxygenase CYP72A16 gene, complete cds.558008592 (3)gb:AB023038_15154131e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041J08+ GTAGTTACTCCCGAAAGCTGTCTGGGAAATG
JMSF034D22+ TGGGAAATG
                      ____________________________________________________________
consensus GTAGTTACTCCCGAAAGCTGTCTGGGAAATG
 
. : . : . : . : . : . :
JMSF041J08+ GCATCACAGGTCAATTGCTGTAGGTGAGGCCACACATCTATCTCTGAACATCCTTCNTCA
JMSF034D22+ GCATCACAGGTCAATTGCTGTAGGTGAGGCCACACATCTATCTCTGAACATCCTTCCTCA
                      ____________________________________________________________
consensus GCATCACAGGTCAATTGCTGTAGGTGAGGCCACACATCTATCTCTGAACATCCTTCCTCA
 
. : . : . : . : . : . :
JMSF041J08+ GGCATAATCTTCTCCCATTTGCCCAACATCTCAGCACAACTCGTGTAGAAAGCCGGCAGC
JMFF009C23+ TCTTCTCCCATTTGCCCAACATCTCAGCACAACTCGTGTAGAAAGCCGGCAGC
JMSF034D22+ GGCATAATCTTCTCCCATTTGCCCAACATCTCAGCACAACTCGTGTAGAAAGCCGGCAGC
                      ____________________________________________________________
consensus GGCATAATCTTCTCCCATTTGCCCAACATCTCAGCACAACTCGTGTAGAAAGCCGGCAGC
 
. : . : . : . : . : . :
JMSF041J08+ ATATGCTTTAACTTTTCAACATGGAAGGCGGGATTAATGATTTTTCTGTGTTTATTCCAT
JMFF009C23+ ATATGCTTTAACTTTTCAACATGGAAGGCGGGATTAATGATTTTTCTGTGTTTATTCCAT
JMSF034D22+ ATATGCTTTAACTTTTCAACATGGAAGGCGGGATTAATGATTTTTCTGTGTTTATTCCAT
                      ____________________________________________________________
consensus ATATGCTTTAACTTTTCAACATGGAAGGCGGGATTAATGATTTTTCTGTGTTTATTCCAT
 
. : . : . : . : . : . :
JMSF041J08+ TTATCTTCTTCAGAGGCAGCTAGTCCTTCAGCCAACAGTTTGGTGAGTGGACTGAAACGC
JMFF009C23+ TTATCTTCTTCAGAGGCAGCTAGTCCTTCAGCCAACAGTTTGGTGAGTGGACTGAAACGC
JMSF034D22+ TTATCTTCTTCAGAGGCAGCTAGTCCTTCAGCCAACAGTTTGGTGAGTGGACTGAAACGC
                      ____________________________________________________________
consensus TTATCTTCTTCAGAGGCAGCTAGTCCTTCAGCCAACAGTTTGGTGAGTGGACTGAAACGC
 
. : . : . : . : . : . :
JMSF041J08+ GGCTTCTGATAGACAGTATACTTATTTAAGACCTCCTTTATAAGCTCAGGGTCCTTGATG
JMFF009C23+ GGCTTCTGATAGACAGTATACTTATTTAAGACCTCCTTTATAAGCTCAGGGTCCTTGATG
JMSF034D22+ GGCTTCTGATAGACAGTATACTTATTTAAGACCTCCTTTATAAGCTCAGGGTCCTTGATG
                      ____________________________________________________________
consensus GGCTTCTGATAGACAGTATACTTATTTAAGACCTCCTTTATAAGCTCAGGGTCCTTGATG
 
. : . : . : . : . : . :
JMSF041J08+ AACACCATTGGGTTTGGCCCAAGCCATATAAAGCAATTCTCACCATATTCTTGAATGGAA
JMFF009C23+ AACACCATTGGGTTTGGCCCAAGCCATATAAAGCAATTCTCACCATATTCTTGAATGGAA
JMSF034D22+ AACACCATTGGGTTTGGCCCAAGCCATATAAAGCAATTCTCACCATATTCTTGAATGGAA
                      ____________________________________________________________
consensus AACACCATTGGGTTTGGCCCAAGCCATATAAAGCAATTCTCACCATATTCTTGAATGGAA
 
. : . : . : . : . : . :
JMSF041J08+ TCAATGAAGTAAGGAACAATTCTNGAGGCTATGTCATCTGAAAGATTATTCAATGGCGGC
JMFF009C23+ TCAATGAAGTAAGGAACAATTCTTGAGGCTATGTCATCTGAAAGATTATTCAATGGCGGC
JMSF034D22+ TCAATGAAGTAAGGAACAATTCTTGAGGCTATGTCATCTGAAAGATTATTCAATGGCGGC
                      ____________________________________________________________
consensus TCAATGAAGTAAGGAACAATTCTTGAGGCTATGTCATCTGAAAGATTATTCAATGGCGGC
 
. : . : . : . : . : . :
JMSF041J08+ TTGGACTTGGCTTCTCCCAGTGCCTTGTTCAGCTCTCTTAGATCTCCAAGCAAGAAACGA
JMFF009C23+ TTGGACTTGGCTTCTCCCAGTGCCTTGTTCAGCTCTCTTAGATCTCCAAGCAAGAAACGA
JMSF034D22+ TTGGACTTGGCTTCTCCCAGTGCCTTGTTCAGCTCTCTTAGATCTCCAAGCAAGAAACGA
                      ____________________________________________________________
consensus TTGGACTTGGCTTCTCCCAGTGCCTTGTTCAGCTCTCTTAGATCTCCAAGCAAGAAACGA
 
. : . : . : . : . : . :
JMSF041J08+ TAAGAATTCCCCTTGAAGCCCTGTTGTCTAAGGCATTTCTCTAGCTTTCTGGGCTTCAAC
JMFF009C23+ TAAGAATTCCCCTTGAAGCCCTGTTGTCTAAGGCATTTCTCTAGCTTTCTGGGCTTCAAC
JMSF034D22+ TAAGAATTCCCCTTGAAGCCCTGTTGTCTAAGGCATTTCTCTAGCTTTCTGGGCTTCAAC
                      ____________________________________________________________
consensus TAAGAATTCCCCTTGAAGCCCTGTTGTCTAAGGCATTTCTCTAGCTTTCTGGGCTTCAAC
 
. : . : . : . : . : . :
JMSF041J08+ CATGCCCAGTTCAAAGCTCTCCAGGAAAGTACAAAGATAGCTACTGCAAATGGAAAAGCT
JMFF009C23+ CATGCCCAGTTCAAAGCTCTCCAGGAAAGTACAAAGATAGCTACTGCAAATGGAAAAGCT
JMSF034D22+ CATGCCCAGTTCAAAGCTCTCCAGGAAAGTACAAAGATAGCTACTGCAAATGGAAAAGCT
                      ____________________________________________________________
consensus CATGCCCAGTTCAAAGCTCTCCAGGAAAGTACAAAGATAGCTACTGCAAATGGAAAAGCT
 
. : . : . : . : . : . :
JMSF041J08+ AATAGGCCATGAACACTCTCCATCTAAGTATTTGGGAGAAGAAAAATGGAT
JMFF009C23+ AAT
JMSF034D22+ AATAGGCCATGAACACTCTCCATCTAAGTATTTGGGAGAAGAAAAATGGATACTATTCTC
                      ____________________________________________________________
consensus AATAGGCCATGAACACTCTCCATCTAAGTATTTGGGAGAAGAAAAATGGATACTATTCTC