Previous Contig 006929:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028I13Sequence522006929 (3)455009551 (3)
JMSF022A18Sequence665006929 (3)pir|C84632|C846323e-07hypothetical protein At2g24070 [imported] - Arabidopsis thaliana>gb:AC005170_153136008187 (4)
JMSF034D05Sequence673006929 (3)685009551 (3)pir|D85359|D853593e-22hypothetical protein AT4g30710 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022A18+ GCGATGAAACTGTAGAGGAAGAGGTTCCTGTTCGTCGAACATTTGGGGAAGGGGTACG
                      ____________________________________________________________
consensus GCGATGAAACTGTAGAGGAAGAGGTTCCTGTTCGTCGAACATTTGGGGAAGGGGTACG
 
. : . : . : . : . : . :
JMSF022A18+ CCTAGGAGTGGGGGATTTGTACCTAGAACTAATTTCTCTGGTTTGAGAACGGCGAGTGGC
                      ____________________________________________________________
consensus CCTAGGAGTGGGGGATTTGTACCTAGAACTAATTTCTCTGGTTTGAGAACGGCGAGTGGC
 
. : . : . : . : . : . :
JMFF028I13+ GCCGGAAACAATGGTGGTTGTGGGATCTCCGCTGCTGAAAA
JMSF022A18+ GATTCCATTATTCATGTCGGCCGGAAACAATGGTGGTTGTGGGATCTCCGCTGCTGAAAA
JMSF034D05+ CCGCTGCTGAAAA
                      ____________________________________________________________
consensus GATTCCATTATTCATGTCGGCCGGAAACAATGGTGGTTGTGGGATCTCCGCTGCTGAAAA
 
. : . : . : . : . : . :
JMFF028I13+ GCTTGTTTGGTGCCTGCTGTGGTTCATACACATCCATCCAAACTGTCCAAATTAGACCAC
JMSF022A18+ GCTTGTTTGGTGCCTGCTGTGGTTCATACACATCCATCCAAACTGTCCAAATTAGACCAC
JMSF034D05+ GCTTGTTTGGTGCCTGCTGTGGTTCATACACATCCATCCAAACTGTCCAAATTAGACCAC
                      ____________________________________________________________
consensus GCTTGTTTGGTGCCTGCTGTGGTTCATACACATCCATCCAAACTGTCCAAATTAGACCAC
 
. : . : . : . : . : . :
JMFF028I13+ ATTGGTGCCCTCTCTTTCACACAATAATTAACCACATTTCTGACAGACTTTCACAAAAAC
JMSF022A18+ ATTGGTGCCCTCTCTTTCACACAATAATTAACCACATTTCTGACAGACTTTCACAAAAAC
JMSF034D05+ ATTGGTGCCCTCTCTTTCACACAATAATTAACCACATTTCTGACAGACTTTCACAAAAAC
                      ____________________________________________________________
consensus ATTGGTGCCCTCTCTTTCACACAATAATTAACCACATTTCTGACAGACTTTCACAAAAAC
 
. : . : . : . : . : . :
JMFF028I13+ CCCCACATTAATCTGATTATAATTCCCACCAATTGCTCTCTTAAAGAAGACTCCTTTTTC
JMSF022A18+ CCCCACATTAATCTGATTATAATTCCCACCAATTGCTCTCTTAAAGAAGACTCCTTTTTC
JMSF034D05+ CCCCACATTAATCTGATTATAATTCCCACCAATTGCTCTCTTAAAGAAGACTCCTTTTTC
                      ____________________________________________________________
consensus CCCCACATTAATCTGATTATAATTCCCACCAATTGCTCTCTTAAAGAAGACTCCTTTTTC
 
. : . : . : . : . : . :
JMFF028I13+ TGGAATAAAT------CCAGATCTGAAGACGGATGAACAGGGTACTGGTGGGATTCTGGG
JMSF022A18+ TGGAATAAAT------CCAGATCTGAAGACGGATGAACAGGGTACTGGTGGGATTCTGGG
JMSF034D05+ TGGAATAAATAGATACCCAGATCTGAAGACGGATGAACAGGGTACTGGTGGGATTCTGGG
                      ____________________________________________________________
consensus TGGAATAAAT------CCAGATCTGAAGACGGATGAACAGGGTACTGGTGGGATTCTGGG
 
. : . : . : . : . : . :
JMFF028I13+ AACAAATCAATGCCAATGGGTATTCTCTACAAATCAAGAGTATAGCAAAAACAGGCAGAT
JMSF022A18+ AACAAATCAATGCCAATGGGTATTCTCTACAAATCAAGAGTATAGCAAAAACAGGCAGAT
JMSF034D05+ AACAAATCAATGCCAATGGGTATTCTCTACAAATCAAGAGTATAGCAAAAACAGGCAGAT
                      ____________________________________________________________
consensus AACAAATCAATGCCAATGGGTATTCTCTACAAATCAAGAGTATAGCAAAAACAGGCAGAT
 
. : . : . : . : . : . :
JMFF028I13+ CAGAGCCAAGAAAAGCTCAATAAGTGACTACTCTCCAGTCTCCACATACACCCAGTTGTA
JMSF022A18+ CAGAGCCAAGAAAAGCTCAATAAGTGACTACTCTCCAGTCTCCACATACACCCAGTTGTA
JMSF034D05+ CAGAGCCAAGAAAAGCTCAATAAGTGACTACTCTCCAGTCTCCACATACACCCAGTTGTA
                      ____________________________________________________________
consensus CAGAGCCAAGAAAAGCTCAATAAGTGACTACTCTCCAGTCTCCACATACACCCAGTTGTA
 
. : . : . : . : . : . :
JMFF028I13+ TTTTATGAACAAAAATGTACATTCCCAGTGATAACAAAGGGATTCACAAGTCCAAAACCT
JMSF022A18+ TTTTATGAACAAAAATGTACATTCCCAGTGATAACAAAGGGATTCACAAGTCCAAAACCT
JMSF034D05+ TTTTATGAACAAAAATGTACATTCCCAGTGATAACAAAGGGATTCACAAGTCCAAAACCT
                      ____________________________________________________________
consensus TTTTATGAACAAAAATGTACATTCCCAGTGATAACAAAGGGATTCACAAGTCCAAAACCT
 
. : . : . : . : . : . :
JMFF028I13+ TCCCAATCAAGATGAGTCGAAATGGGGAAGAGTTAAAGAGGGAAAAACAAGTGACGTGTA
JMSF022A18+ TCCCAATCAAGATGAGTCGAAATGGGGAAGAGTTAAAGAGGGAAAAACAAGTGACGTGTA
JMSF034D05+ TCCCAATCAAGATGAGTCGAAATGGGGAAGAGTTAAAGAGGGAAAAACAAGTGACGTGTA
                      ____________________________________________________________
consensus TCCCAATCAAGATGAGTCGAAATGGGGAAGAGTTAAAGAGGGAAAAACAAGTGACGTGTA
 
. : . : . : . : . : . :
JMFF028I13+ GAACAAC
JMSF022A18+ GAACAAC
JMSF034D05+ GAACAACAAATCAAAAAAGGTACAGTGAGTTTAAGTCTTTAAAGAGTTTTACTCCCTACA
                      ____________________________________________________________
consensus GAACAACAAATCAAAAAAGGTACAGTGAGTTTAAGTCTTTAAAGAGTTTTACTCCCTACA
 
. : . : . : . : . : . :
JMSF034D05+ TGGCTACATATATATTGTCTTCTTTCCAAACCTTTTTTCTTTTTGACTCATCCCAAACTT
                      ____________________________________________________________
consensus TGGCTACATATATATTGTCTTCTTTCCAAACCTTTTTTCTTTTTGACTCATCCCAAACTT
 
. : . : . : . : . : . :
JMSF034D05+ TGTCTCTCTCCTTCTCACGAGAGTGCCATGGTCAGCTGGACACACAAGCACTCACTGTCC
                      ____________________________________________________________
consensus TGTCTCTCTCCTTCTCACGAGAGTGCCATGGTCAGCTGGACACACAAGCACTCACTGTCC