Previous Contig 006926:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS080E06Sequence617006926 (4)
JMSF022C20Sequence674006926 (4)737013506 (3)gb:AP003524_18303803e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P050
JMSF034C17Sequence687006926 (4)735013506 (3)gb:AP003524_18303803e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P050
JMSF043M20Sequence741006926 (4)709013506 (3)gb:AP003524_18303803e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P050

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043M20+ CTTCAACCTTGGCAGTATCAG
                      ____________________________________________________________
consensus CTTCAACCTTGGCAGTATCAG
 
. : . : . : . : . : . :
JMSF022C20+ TTTTACCTGGTCAT
JMSF043M20+ AGCCAATCACACCCTTAGCATCATTCTTGTCTTCTGTAGAAGCTACTTTTCCCTGGTCAT
JMFS080E06+ TTTTCCCTGGTCAT
JMSF034C17+ TTTTCCCTGGTCAT
                      ____________________________________________________________
consensus AGCCAATCACACCCTTAGCATCATTCTTGTCTTCTGTAGAAGCTACTTTTCCCTGGTCAT
 
. : . : . : . : . : . :
JMSF022C20+ CATGGGCAACTGAGGAGTCCTCTGAGCCAGCACGTATAGGTCCTTCACTTGAACCCTCAT
JMSF043M20+ CATGGGCAACTGAGGAGTCCTCTGAGCCAGCACGTATAGGTCCTTCACTTGAACCCTCAT
JMFS080E06+ CATGGGCAACTGAGGAGTCCTCTGAGCCAGCACGTATAGGTCCTTCACTTGAACCCTCAT
JMSF034C17+ CATGGGCAACTGAGGAGTCCTCTGAGCCAGCACGTATAGGTCCTTCACTTGAACCCTCAT
                      ____________________________________________________________
consensus CATGGGCAACTGAGGAGTCCTCTGAGCCAGCACGTATAGGTCCTTCACTTGAACCCTCAT
 
. : . : . : . : . : . :
JMSF022C20+ CCAACTCATCATCACTATACTGCCCAAGCAACATTAGAGGATTCTCTTGTTGAAGACCGA
JMSF043M20+ CCAACTCATCATCACTATACTGCCCAAGCAACATTAGAGGATTCTCTTGTTGAAGACCGA
JMFS080E06+ CCAACTCATCATCACTATACTGCCCAAGCAACATTAGAGGATTCTCTTGTTGAAGACCGA
JMSF034C17+ CCAACTCATCATCACTATACTGCCCAAGCAACATTAGAGGATTCTCTTGTTGAAGACCGA
                      ____________________________________________________________
consensus CCAACTCATCATCACTATACTGCCCAAGCAACATTAGAGGATTCTCTTGTTGAAGACCGA
 
. : . : . : . : . : . :
JMSF022C20+ GAGGAGAAAATACTCTTCATTTTATCTCCACAAGCCTTTGATGCCGCCATAGAAGGACAT
JMSF043M20+ GAGGAGAAAATACTCTTCATTTTATCTCCACAAGCCTTTGATGCCGCCATAGAAGGACAT
JMFS080E06+ GAGGAGAAAATACTCTTCATTTTATCTCCACAAGCCTTTGATGCCGCCATAGAAGGACAT
JMSF034C17+ GAGGAGAAAATACTCTTCATTTTATCTCCACAAGCCTTTGATGCCGCCATAGAAGGACAT
                      ____________________________________________________________
consensus GAGGAGAAAATACTCTTCATTTTATCTCCACAAGCCTTTGATGCCGCCATAGAAGGACAT
 
. : . : . : . : . : . :
JMSF022C20+ GAAAGGTAAGAAGTTATTCAATATTCACTGTGGCAGGGCCTTGATGTATACTGATGGCCA
JMSF043M20+ GAAAGGTAAGAAGTTATTCAATATTCACTGTGGCAGGGCCTTGATGTATACTGATGGCCA
JMFS080E06+ GAAAGGTAAGAAGTTATTCAATATTCACTGTGGCAGGGCCTTGATGTATACTGATGGCCA
JMSF034C17+ GAAAGGTAAGAAGTTATTCAATATTCACTGTGGCAGGGCCTTGATGTATACTGATGGCCA
                      ____________________________________________________________
consensus GAAAGGTAAGAAGTTATTCAATATTCACTGTGGCAGGGCCTTGATGTATACTGATGGCCA
 
. : . : . : . : . : . :
JMSF022C20+ ATTGAAAGTTCCCAATACCACAGCCTGGTTACAGACTGAAAACATAATCTTTTGTGGAAC
JMSF043M20+ ATTGAAAGTTCCCAATACCACAGCCTGGTTACAGACTGAAAACATAATCTTTTGTGGAAC
JMFS080E06+ ATTGAAAGTTCCCAATACCACAGCCTGGTTACAGACTGAAAACATAATCTTTTGTGGAAC
JMSF034C17+ ATTGAAAGTTCCCAATACCACAGCCTGGTTACAGACTGAAAACATAATCTTTTGTGGAAC
                      ____________________________________________________________
consensus ATTGAAAGTTCCCAATACCACAGCCTGGTTACAGACTGAAAACATAATCTTTTGTGGAAC
 
. : . : . : . : . : . :
JMSF022C20+ AAACAACATGTCTTGTACAAAGAAAATCAATAATTTCCACCAATATTATGCGGTCACATC
JMSF043M20+ AAACAACATGTCTTGTACAAAGAAAATCAATAATTTCCACCAATATTATGCGGTCACATC
JMFS080E06+ AAACAACATGTCTTGTACAAAGAAAATCAATAATTTCCACCAATATTATGCGGTCACATC
JMSF034C17+ AAACAACATGTCTTGTACAAAGAAAATCAATAATTTCCACCAATATTATGCGGTCACATC
                      ____________________________________________________________
consensus AAACAACATGTCTTGTACAAAGAAAATCAATAATTTCCACCAATATTATGCGGTCACATC
 
. : . : . : . : . : . :
JMSF022C20+ ATGTCTTCTCTACAAAGATGTCCTTTTGAAGAAAACTCACAGAACCCACCTGAAGATGAT
JMSF043M20+ ATGTCTTCTCTACAAAGATGTCCTTTTGAAGAAAACTCACAGAACCCACCTGAAGATGAT
JMFS080E06+ ATGTCTTCTCTACAAAGATGTCCTTTTGAAGAAAACTCACAGAACCCACCTGAAGATGAT
JMSF034C17+ ATGTCTTCTCTACAAAGATGTCCTTTTGAAGAAAACTCACAGAACCCACCTGAAGATGAT
                      ____________________________________________________________
consensus ATGTCTTCTCTACAAAGATGTCCTTTTGAAGAAAACTCACAGAACCCACCTGAAGATGAT
 
. : . : . : . : . : . :
JMSF022C20+ GGTGAATTGGGTAGCTCAGCTTGATTTTTGGAAGCTTCATCCCCTCCAACTCCATCTTGA
JMSF043M20+ GGTGAATTGGGTAGCTCAGCTTGATTTTTGGAAGCTTCATCCCCTCCAACTCCATCTTGA
JMFS080E06+ GGTGAATTGGGTAGCTCAGCTTGATTTTTGGAAGCTTCATCCCCTCCAACTCCATCTTGA
JMSF034C17+ GGTGAATTGGGTAGCTCAGCTTGATTTTTGGAAGCTTCATCCCCTCCAACTCCATCTTGA
                      ____________________________________________________________
consensus GGTGAATTGGGTAGCTCAGCTTGATTTTTGGAAGCTTCATCCCCTCCAACTCCATCTTGA
 
. : . : . : . : . : . :
JMSF022C20+ GAAGAGCCACCCAAATCTCCAGAGGGTTCCGCGAAGAGGTCAAGCTTTACTCTGCGACTG
JMSF043M20+ GAAGAGCCACCCAAATCTCCAGAGGGTTCCGCGAAGAGGTCAAGCTTTACTCTGCGACTG
JMFS080E06+ GAAGAGCCACCCAAATCTCCAGAGGGTTCCGCGAAGAGGTCAAGCTTTACTCTGCGACTG
JMSF034C17+ GAAGAGCCACCCAAATCTCCAGAGGGTTCCGCGAAGAGGTCAAGCTTTACTCTGCGACTG
                      ____________________________________________________________
consensus GAAGAGCCACCCAAATCTCCAGAGGGTTCCGCGAAGAGGTCAAGCTTTACTCTGCGACTG
 
. : . : . : . : . : . :
JMSF022C20+ GAGGCGCTCATGGCGGCGAGCCGGCGCTCTTTTCTCTTTCCCATATTCTAAAACGACGAT
JMSF043M20+ GAGGCGCTCATGGCGGCGAGCCGGCGCTCTTTTCTCTTTCCCATATTCTAAAACGACGAT
JMFS080E06+ GAGGCGCTCATGGCGGCGAGCCGGCGCTCTTTTCTCTTTCCCATATTCTAAAACGA
JMSF034C17+ GAGGCGCTCATGGCGGCGAGCCGGCGCTCTTTTCTCTTTCCCATATTCTAAAACGACGAT
                      ____________________________________________________________
consensus GAGGCGCTCATGGCGGCGAGCCGGCGCTCTTTTCTCTTTCCCATATTCTAAAACGACGAT
 
. : . : . : . : . : . :
JMSF022C20+ TTGACGGAGTTTTGATCGGT
JMSF043M20+ TTGACGGAGTTTTGATCGGTGATTAAATCAGCTAAAATTCTTCAGCTATATATGTTTCTC
JMSF034C17+ TTGACGGAGTTTTGATCGGTGATTAAATCAGCTAAAATTCTTCAGCTATATATGTTTCTC
                      ____________________________________________________________
consensus TTGACGGAGTTTTGATCGGTGATTAAATCAGCTAAAATTCTTCAGCTATATATGTTTCTC