Previous Contig 006921:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B16Sequence547006921 (8)pir|T50532|T505328e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha544006921 (8)pir|T50532|T505328e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFN012N05Sequence532006921 (8)pir|T50532|T505324e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFN018L17Sequence530006921 (8)pir|T50532|T505328e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFN039J21Sequence528006921 (8)pir|T50532|T505328e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFS040B08Sequence476006921 (8)pir|T50532|T505326e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMSF034B02Sequence563006921 (8)pir|T50532|T505329e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha504006921 (8)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS040B08+ AGTAAAAATT
JMFF002B16+ TAGTAAAAATT
JMFN012N05+ AGTAAAAATT
rJMSF034B02- CAGATGCATGTGCTAGTAAAAATT
                      ____________________________________________________________
consensus CAGATGCATGTGCTAGTAAAAATT
 
. : . : . : . : . : . :
JMFS040B08+ GAATCTTTCATTCAATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
rJMFF002B16- ATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
JMFF002B16+ GAATCTTTCATTCAATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
JMFN012N05+ GAATCTTTCATTCAATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
rJMSF034B02- GAATCTTTCATTCAATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
                      ____________________________________________________________
consensus GAATCTTTCATTCAATAACATAATCTTTCAGATGCATAATTTTGAAACGCCACAAATCTG
 
. : . : . : . : . : . :
JMFS040B08+ AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
rJMFF002B16- AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
JMFF002B16+ AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
JMFN012N05+ AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
rJMSF034B02- AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
                      ____________________________________________________________
consensus AAATGTGAGTCTTAAAACAAACTAACTCAAAATTTAGGCATATCAGTTCCCCATTAAACT
 
. : . : . : . : . : . :
JMFN039J21- TTAGTCACCCTTTCTCCTGAAAGAGCATCCC
JMFS040B08+ TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
rJMFF002B16- TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
JMFF002B16+ TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
JMFN012N05+ TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
JMFN018L17+ TTAGTCACCCTTTCTCCTGAAAGAGCATCCC
rJMSF034B02- TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
JMSF034B02+ TTAGTCACCCTTTCTCCTGAAAGAGCATCCC
                      ____________________________________________________________
consensus TCAAATGGAAATAGGACAAAGGTCTGTGATTAGTCACCCTTTCTCCTGAAAGAGCATCCC
 
. : . : . : . : . : . :
JMFN039J21- TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
JMFS040B08+ TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
rJMFF002B16- TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
JMFF002B16+ TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
JMFN012N05+ TCAGTGAGCTTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
JMFN018L17+ TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
rJMSF034B02- TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
JMSF034B02+ TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
                      ____________________________________________________________
consensus TCAGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGTTCCCACAC
 
. : . : . : . : . : . :
JMFN039J21- ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
JMFS040B08+ ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
rJMFF002B16- ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
JMFF002B16+ ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
JMFN012N05+ ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
JMFN018L17+ ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
rJMSF034B02- ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
JMSF034B02+ ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
                      ____________________________________________________________
consensus ACCACAACCGTCTGAGAGTGACTGAACACAGTTGTTATGTTGAAGCAGCCTTGGCACTTG
 
. : . : . : . : . : . :
JMFN039J21- ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
JMFS040B08+ ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
rJMFF002B16- ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
JMFF002B16+ ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
JMFN012N05+ ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
JMFN018L17+ ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
rJMSF034B02- ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
JMSF034B02+ ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
                      ____________________________________________________________
consensus ACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCTTCTTCTTC
 
. : . : . : . : . : . :
JMFN039J21- TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
JMFS040B08+ TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
rJMFF002B16- TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTT
JMFF002B16+ TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATT
JMFN012N05+ TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATT
JMFN018L17+ TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
rJMSF034B02- TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
JMSF034B02+ TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
                      ____________________________________________________________
consensus TCGAGCTCGGCAGGAGGGTTCAACAAATCGATATCGTTCGGTAGAACCATTGTGTTGAAT
 
. : . : . : . : . : . :
JMFN039J21- GTTGATGAACGAAAACCCTAGAAGGCCGCCGTATG
JMFS040B08+ GTTGATGAACGAAAACCCTAGAAGGCCGCCGTATGAAGAGAGCCGA
JMFN018L17+ GTTGATGAACGAAAACCCTAGAAGGCCGCCGTAT-AAGAGAGCCGA
rJMSF034B02- GTTGATGAACGAAAACCCTAGAAGGCCGCCGTATGAAGAGAGCCGAGAATAGGTTCGTT
JMSF034B02+ GTTGATGAACGAAAACCCTAGAAGGCCGCCGTATGAAGAGAGCCGAGAATAGGTTCGTTC
                      ____________________________________________________________
consensus GTTGATGAACGAAAACCCTAGAAGGCCGCCGTATGAAGAGAGCCGAGAATAGGTTCGTTC