Previous Contig 006919:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003M23Sequence578006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10686006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMFF015C22Sequence496006919 (10)gb:AP003803_18335971e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10631006919 (10)gb:AP003803_18335973e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMFN019M18Sequence627006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMFN025O14Sequence642006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMFN035P05Sequence609006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF034A16Sequence682006919 (10)gb:AP003803_18335977e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10666006919 (10)gb:AP003803_18335976e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF053E07Sequence680000104 (3)gb:AX555216_14704036e-32Sequence 1 from Patent WO02059332.664006919 (10)gb:AP003803_18335971e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025O14+ CA
rJMSF034A16- ATTTCCCA
                      ____________________________________________________________
consensus ATTTCCCA
 
. : . : . : . : . : . :
rJMSF053E07- AAAGGTTCGGTAAAGTTCGCTTTATTAATTTCAAGAAACTTGGCTTGGGCTCA-TTC
JMFN025O14+ TACAAAGGTTCGGTAAAGTTCGCTTTATTAATTTCAAGAAACTTGGCTTGGGCTCA-TTC
JMFN035P05+ ATTTCAAGAAACTTGGC-TGGGCTCATTTC
JMFN019M18+ TAAAGTTCGCTTTATTAATTTCAAGAAACTTGGCTTGGGCTCA-TTC
rJMFF015C22- GGCTTGGGCTCA-TTC
rJMSF034A16- TACAAAGGTTCGGTAAAGTTCGCTTTATTAATTTCAAGAAACTTGGCTTGGGCTCA-TTC
                      ____________________________________________________________
consensus TACAAAGGTTCGGTAAAGTTCGCTTTATTAATTTCAAGAAACTTGGCTTGGGCTCA-TTC
 
. : . : . : . : . : . :
rJMSF053E07- CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
JMFN025O14+ CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
JMFN035P05+ CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
JMFN019M18+ CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
JMFF003M23+ TTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
rJMFF015C22- ATGAAGACACACCCAAAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
rJMSF034A16- CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
                      ____________________________________________________________
consensus CTGAAGACACACCC-AAACTTTATAAGTTAAGCAAGATGCAAGAGACACTATTTATAGCC
 
. : . : . : . : . : . :
rJMSF053E07- TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
JMFN025O14+ TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
JMFN035P05+ TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
JMFN019M18+ TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
rJMFF003M23- TCCACTTGAAATTGTCG
JMFF015C22+ TCCACTTGAAATTGTCG
JMFF003M23+ TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
rJMFF015C22- TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
rJMSF034A16- TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAATTTGTCG
                      ____________________________________________________________
consensus TGAGAGAAAATTTCAATTCATCCCTCCATCTTGGGAGGGCCTCTCCACTTGAAATTGTCG
 
. : . : . : . : . : . :
rJMSF053E07- GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMFN025O14+ GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMFN035P05+ GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMFN019M18+ GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
rJMFF003M23- GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMFF015C22+ GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMFF003M23+ GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
rJMFF015C22- GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
rJMSF034A16- GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
JMSF034A16+ CCGTATACTCCCATCCA
                      ____________________________________________________________
consensus GCATAGGCCTTAATCTTCAACAATGGTGTATGGTGTTTCTTGACCGTATACTCCCATCCA
 
. : . : . : . : . : . :
rJMSF053E07- TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMFN025O14+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMFN035P05+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMFN019M18+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
rJMFF003M23- TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMFF015C22+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMFF003M23+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
rJMFF015C22- TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
rJMSF034A16- TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
JMSF034A16+ TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
                      ____________________________________________________________
consensus TGTCTTTCAGCAAATGCTTTTGCAGCATCTTCACTGTCAAAGCCCAGCGCAGCATCACCA
 
. : . : . : . : . : . :
rJMSF053E07- ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
JMFN025O14+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
JMFN035P05+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
JMFN019M18+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
rJMFF003M23- ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
JMFF015C22+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGTGTTTTCCCATTCCTGA
JMFF003M23+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
rJMFF015C22- ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGTGTTTTCCCATTCCTGA
rJMSF034A16- ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
JMSF034A16+ ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
                      ____________________________________________________________
consensus ACATTGGCATATGCATCCCCTGTGGACGTCCAACCCATCAATGGGTTTTCCCATTTCTGA
 
. : . : . : . : . : . :
rJMSF053E07- GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMFN025O14+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMFN035P05+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMFN019M18+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
rJMFF003M23- GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMFF015C22+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMFF003M23+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
rJMFF015C22- GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
rJMSF034A16- GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
JMSF034A16+ GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
                      ____________________________________________________________
consensus GTCGATAAAAAGTTGATTTTCCATCTCCCAACTTTTCCAGATCCTTGCTGACTAGCAGTT
 
. : . : . : . : . : . :
rJMSF053E07- CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMFN025O14+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMFN035P05+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMFN019M18+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
rJMFF003M23- CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMFF015C22+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMFF003M23+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
rJMFF015C22- CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
rJMSF034A16- CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
JMSF034A16+ CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
                      ____________________________________________________________
consensus CGCGCAGGAGAGAAAATAATAACCTTCCTACGAAGATGCTCTTGGGGTATACCGGAGACC
 
. : . : . : . : . : . :
rJMSF053E07- ATACCGATCTCTCCCCGTTGGATCTC
JMFN025O14+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
JMFN035P05+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
JMFN019M18+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
rJMFF003M23- ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
JMFF015C22+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
JMFF003M23+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
rJMFF015C22- ATACCGATCTCTCCCCGTTGGATCTC
rJMSF034A16- ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
JMSF034A16+ ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
                      ____________________________________________________________
consensus ATACCGATCTCTCCCCGTTGGATCTCTACGAGTGAGTCCGATAATGCAGAGAAAGACCTC
 
. : . : . : . : . : . :
JMFN025O14+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
JMFN035P05+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
JMFN019M18+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
rJMFF003M23- GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
JMFF015C22+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
JMFF003M23+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
rJMSF034A16- GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
JMSF034A16+ GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
                      ____________________________________________________________
consensus GATAATGGAGTCAGAGGGTATCGATAGGGCTGACGCGAATGCGTCACTGCTCGCCGCAGG
 
. : . : . : . : . : . :
JMFN025O14+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGC
JMFN035P05+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTG
JMFN019M18+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGC
rJMFF003M23- GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCAT
JMFF015C22+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCA
JMFF003M23+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCAT
rJMSF034A16- GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCAT
JMSF034A16+ GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCATACC
                      ____________________________________________________________
consensus GAGCTCGCCATTTCCCGGAGCAGAGATGATCGCAAACCTTGCGCAGAATGGGCGCATACC