Previous Contig 006916:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D10Sequence594006916 (3)pir|T05433|T054332e-56hypothetical protein F28A23.210 - Arabidopsis thaliana>gb:ATCHRIV80_1547364 Arab741008314 (3)gb:AP005537_18537237e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS053F01Sequence609006916 (3)gb:ATF17I5_15489563e-62Arabidopsis thaliana DNA chromosome 4, BAC clone F17I5 (ESSA project).
JMSF033O15Sequence658006916 (3)gb:ATF17I5_15489562e-64Arabidopsis thaliana DNA chromosome 4, BAC clone F17I5 (ESSA project).724008314 (3)gb:AF386926_17947313e-44Arabidopsis thaliana Unknown protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004D10+ TCAACAAGATATAGACAGGGTAGTTTGCATTGTGCAGCAATTTCTTGAGCTCTCAGAT
JMFS053F01+ GACAGGGTAGTNTGCATTGTGCAGCAATTTCTTGAGCTCTCAGAT
JMSF033O15+ TCAACAAGATATAGACAGGGTAGTTTGCATTGTGCAGCAATTTCTTGAGCTCTCAGAT
                      ____________________________________________________________
consensus TCAACAAGATATAGACAGGGTAGTTTGCATTGTGCAGCAATTTCTTGAGCTCTCAGAT
 
. : . : . : . : . : . :
JMFF004D10+ GTTTCTTGACTGTGATGGGGAAATAAGTTCCACCTTTGACAGTAGGGTCATTTGCCACGA
JMFS053F01+ GTTTCTTGACTGTGATGGGGAAATAAGTTCCACCTTTGACAGTAGGGTCATTTGCCACGA
JMSF033O15+ GTTTCTTGACTGTGATGGGGAAATAAGTTCCACCTTTGACAGTAGGGTCATTTGCCACGA
                      ____________________________________________________________
consensus GTTTCTTGACTGTGATGGGGAAATAAGTTCCACCTTTGACAGTAGGGTCATTTGCCACGA
 
. : . : . : . : . : . :
JMFF004D10+ ACATGCAAAGTCTTCCATGCACTGGTCCTATTCCAGTAATTATTCCACCAGAAGGTAATG
JMFS053F01+ ACATGCAAAGTCTTCCATGCACTGGTCCTATTCCAGTAATTATTCCACCAGAAGGTAATG
JMSF033O15+ ACATGCAAAGTCTTCCATGCACTGGTCCTATTCCAGTAATTATTCCACCAGAAGGTAATG
                      ____________________________________________________________
consensus ACATGCAAAGTCTTCCATGCACTGGTCCTATTCCAGTAATTATTCCACCAGAAGGTAATG
 
. : . : . : . : . : . :
JMFF004D10+ GATCCTCATATAATTCATGGCCTGCAAGTGGAGAAAGCTCTAGGAACGAAGAACCAGGGT
JMFS053F01+ GATCCTCATATAATTCATGGCCTGCAAGTGGAGAAAGCTCTAGGAACGAAGAACCAGGGT
JMSF033O15+ GATCCTCATATAATTCATGGCCTGCAAGTGGAGAAAGCTCTAGGAACGAAGAACCAGGGT
                      ____________________________________________________________
consensus GATCCTCATATAATTCATGGCCTGCAAGTGGAGAAAGCTCTAGGAACGAAGAACCAGGGT
 
. : . : . : . : . : . :
JMFF004D10+ CGAGCAGACGATCGATTCTCTCTCTCGGAAGAAGCTTATTCCTGCTTCTGTTT-TCTCAA
JMFS053F01+ CGAGCAGACGATCGATTCTCTCTCTCGGAAGAAGCTTATTCCTGCTTCTGTTTCTCTCAA
JMSF033O15+ CGAGCAGACGATCGATTCTCTCTCTCGGAAGAAGCTTATTCCTGCTTCTGTTTCTCTCAA
                      ____________________________________________________________
consensus CGAGCAGACGATCGATTCTCTCTCTCGGAAGAAGCTTATTCCTGCTTCTGTTTCTCTCAA
 
. : . : . : . : . : . :
JMFF004D10+ CGGCCGCCGGTCCTCCTCCTTCGGTCACCTTCCGGATATGAGAGTGAAGCTGGGAGACGA
JMFS053F01+ CGGCCGCCGGTCCTCCTCCTTCGGTCACCTTCCGGATATGAGAGTGAAGCTGGGAGACGA
JMSF033O15+ CGGCCGCCGGTCCTCCTCCTTCGGTCACCTTCCGGATATGAGAGTGAAGCTGGGAGACGA
                      ____________________________________________________________
consensus CGGCCGCCGGTCCTCCTCCTTCGGTCACCTTCCGGATATGAGAGTGAAGCTGGGAGACGA
 
. : . : . : . : . : . :
JMFF004D10+ GATCGTCCATGGCCTTGGAATTGCTGGTAAATACATCGGAGCTCCGGTCCAGCGTGTCGG
JMFS053F01+ GATCGTCCATGGCCTTGGAATTGCTGGTAAATACATCGGAGCTCCGGTCCAGCGTGTCGG
JMSF033O15+ GATCGTCCATGGCCTTGGAATTGCTGGTAAATACATCGGAGCTCCGGTCCAGCGTGTCGG
                      ____________________________________________________________
consensus GATCGTCCATGGCCTTGGAATTGCTGGTAAATACATCGGAGCTCCGGTCCAGCGTGTCGG
 
. : . : . : . : . : . :
JMFF004D10+ GGAGTACTCCTACGGAGAAAGTTCGGGCGGTGGGAATGGTGATCTGAAGGGATTCCCGCC
JMFS053F01+ GGAGTACTCCTACGGAGAAAGTTCGGGCGGTGGGAATGGTGATCGGAAGGGATTCCCGCC
JMSF033O15+ GGAGTACTCCTACGGAGAAAGTTCGGGCGGTGGGAATGGTGATCGGAAGGGATTCCCGCC
                      ____________________________________________________________
consensus GGAGTACTCCTACGGAGAAAGTTCGGGCGGTGGGAATGGTGATCGGAAGGGATTCCCGCC
 
. : . : . : . : . : . :
JMFF004D10+ ATGGAAACCAGTATCGTGAAGCTGACGGCGATGCTCTCCGAGCTAATATTCCGAGCATTT
JMFS053F01+ ATGGAAACCAGTATCGTGAAGCTGACGGCGATGCTCTCCGAGCTAATATTCCGAGCATTT
JMSF033O15+ ATGGAAACCAGTATCGTGAAGCTGACGGCGATGCTCTCCGAGCTAATATTCCGAGCATTT
                      ____________________________________________________________
consensus ATGGAAACCAGTATCGTGAAGCTGACGGCGATGCTCTCCGAGCTAATATTCCGAGCATTT
 
. : . : . : . : . : . :
JMFF004D10+ TCGCTAAATTCGTATCCTCCTGTCCTCTTAACGTCTCCCCCTTCTTCCCAAATCTAC
JMFS053F01+ TCGCTAAATTCGTATCCTCCTGTCCTCTTAACGTCTCCCCCTTCTTCCCAAATCTACACT
JMSF033O15+ TCGCTAAATTCGTATCCTCCTGTCCTCTTAACGTCTCCCCCTTCTTCCCAAATCTACACT
                      ____________________________________________________________
consensus TCGCTAAATTCGTATCCTCCTGTCCTCTTAACGTCTCCCCCTTCTTCCCAAATCTACACT
 
. : . : . : . : . : . :
JMFS053F01+ CCTTTCGGACTGATGTGAGTGTAA
JMSF033O15+ CCTTTCGGACTGATGTGAGTGTAATTTTAATTTTTCTCTATCGATACCTCGATCAAATCC
                      ____________________________________________________________
consensus CCTTTCGGACTGATGTGAGTGTAATTTTAATTTTTCTCTATCGATACCTCGATCAAATCC