Previous Contig 006915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002E05Sequence512006915 (20)gb:AF098458_17679151e-65Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMFF004K24Sequence419006915 (20)gb:AF098458_17679153e-30Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMFF023N23Sequence431006915 (20)gb:AF098458_17679155e-48Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.729006915 (20)gb:AF098458_17679159e-66Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMFF035B03Sequence432006915 (20)gb:AF098458_17679151e-49Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.700006915 (20)gb:AF098458_17679154e-61Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMFN017O19Sequence560006915 (20)gb:AF098458_17679152e-37Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF011G08Sequence402006915 (20)gb:AF098458_17679153e-44Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.682006915 (20)gb:AF098458_17679158e-59Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF014P04Sequence493006915 (20)gb:AF098458_17679151e-60Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.752006915 (20)gb:AF098458_17679151e-71Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF019F13Sequence583009612 (10)gb:AY863051_16309851e-28Zea mays putative methyl-binding domain protein MBD115 mRNA, complete cds.629006915 (20)gb:AF098458_17679152e-53Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF021F08Sequence691006915 (20)gb:AF098458_17679151e-69Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.812006915 (20)gb:AF098458_17679154e-75Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF021L23Sequence692006915 (20)gb:AF098458_17679151e-69Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.698006915 (20)gb:AF098458_17679152e-66Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF024D04Sequence599006915 (20)gb:AF098458_17679152e-65Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.756006915 (20)gb:AF098458_17679153e-65Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF033O14Sequence640006915 (20)gb:AF098458_17679152e-65Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.667006915 (20)gb:AF098458_17679153e-47Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017O19+ ACTAGTAAAAAATAACCTTAATCAAA
                      ____________________________________________________________
consensus ACTAGTAAAAAATAACCTTAATCAAA
 
. : . : . : . : . : . :
JMFN017O19+ CACAATCCTTTTAGTACCAATTACACAAAGAGTAGACATAAACCAATACATATTTTGGTC
rJMSF033O14- ATTACACAAAGAGTAGACATAAACCAATACATATTTTGGTC
rJMSF024D04- TTACACAAAGAGTAGACATAAACCAATACATATTTTGGTC
rJMFF035B03- TATTTTGGTC
rJMFF023N23- TATTTTGGTC
                      ____________________________________________________________
consensus CACAATCCTTTTAGTACCAATTACACAAAGAGTAGACATAAACCAATACATATTTTGGTC
 
. : . : . : . : . : . :
rJMFF004K24- GGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACC
JMFN017O19+ AAAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF033O14- AAAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF024D04- AAAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMFF035B03- -AAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF011G08- GAAACTCTTANGCCCNACTAAAAAAACCAAACACA
rJMFF023N23- -AAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF014P04- GGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF021L23- AGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
rJMSF021F08- CACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
                      ____________________________________________________________
consensus AAAGCTTTATTTAATCCACTGGACAGAAACTCTTAAGCCCAACTAAAAAAACCAAACACA
 
. : . : . : . : . : . :
rJMFF004K24- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCNNTCATAATCNTCATAATATATGCTC
JMFN017O19+ AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF033O14- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF024D04- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMFF035B03- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF011G08- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATANTCATNATAATATATGCTC
rJMSF019F13- ATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMFF023N23- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF014P04- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF021L23- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
rJMSF021F08- AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
                      ____________________________________________________________
consensus AAGCAAGAAGAATACAGATATGGTACTGTTTTTCAGTCATAATCATCATAATATATGCTC
 
. : . : . : . : . : . :
rJMFF004K24- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
JMFN017O19+ ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF033O14- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF024D04- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMFF035B03- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF011G08- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF019F13- ATGAAGTTGGTGATATTATAATATACTATCAGCACACNAAAGANGAACCAACATGAGAGT
rJMFF023N23- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF014P04- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF021L23- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
rJMSF021F08- ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
                      ____________________________________________________________
consensus ATGAAGTTGGTGATATTATAATATACTATCAGCACACAAAAGAAGAACCAACATGAGAGT
 
. : . : . : . : . : . :
rJMFF004K24- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
JMFN017O19+ CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF033O14- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF024D04- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMFF035B03- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF011G08- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF019F13- CAGAGCANTAAAGACCANGGGGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMFF023N23- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF014P04- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF021L23- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
rJMSF021F08- CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
                      ____________________________________________________________
consensus CAGAGCAGTAAAGACCAGGGCGCTGTGAGAACCCTTGCTTTTCCAACATCTCCCTAGCCT
 
. : . : . : . : . : . :
rJMFF004K24- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
JMFN017O19+ TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF033O14- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF024D04- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMFF035B03- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF011G08- TGTGAACNAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGNCTGAATCG
rJMSF019F13- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMFF023N23- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF014P04- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF021L23- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
rJMSF021F08- TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
                      ____________________________________________________________
consensus TGTGAACAAGGTCTTGGTAAGTGACTGGCCCATCTGAGTCTTTGAGTATGGTCTGAATCG
 
. : . : . : . : . : . :
rJMFF004K24- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
JMFN017O19+ CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF033O14- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF024D04- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMFF035B03- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF011G08- CATTGCTGAGGGCGCCNTATGATTCCTGGGGATTGTTGTTAGGAGNAGCATCNGCTGATG
rJMSF019F13- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCANCTGATG
rJMFF023N23- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF014P04- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF021L23- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
rJMSF021F08- CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
                      ____________________________________________________________
consensus CATTGCTGAGGGCGCCATATGATTCCTGGGGATTGTTGTTAGGAGTAGCATCAGCTGATG
 
. : . : . : . : . : . :
rJMFF004K24- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
JMFN017O19+ TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF033O14- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF024D04- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMFF035B03- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF011G08- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF019F13- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMFF023N23- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF014P04- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF021L23- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
rJMSF021F08- TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
                      ____________________________________________________________
consensus TTTGGTCGGTTTGGCAGCCACTGATGAGAATGCCATTGTCTGGGAAATCCTTTTGGCTTG
 
. : . : . : . : . : . :
rJMFF004K24- GTC
JMFN017O19+ GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCA
rJMSF033O14- GTCCAGCATAAGCGTACTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMSF024D04- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMFF035B03- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMSF011G08- GTCCANCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCNCATAAT
rJMSF019F13- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMFF023N23- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMSF014P04- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMSF021L23- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
rJMSF021F08- GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
                      ____________________________________________________________
consensus GTCCAGCATAAGCGTCTTGCTTGCTTCCTACAGGTGTTTCCAGAGCAGGTTTCACATAAT
 
. : . : . : . : . : . :
rJMSF033O14- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF024D04- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMFF035B03- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF011G08- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF019F13- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMFF023N23- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF014P04- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF021L23- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
rJMSF021F08- TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
                      ____________________________________________________________
consensus TCTCATCGTTTTGCTCAAGCTTAGTCTTTAGAATTTCCAGAGCCAAGCCCCCAACCATCC
 
. : . : . : . : . : . :
rJMSF033O14- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF024D04- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMFF035B03- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF011G08- CCAAAAAGCCACCACCCCCTCNAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF019F13- CCAAAAAGCCNCCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMFF023N23- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF014P04- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF021L23- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
rJMSF021F08- CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
                      ____________________________________________________________
consensus CCAAAAAGCCACCACCCCCTCCAGTACCTTCGCCACTCTGAAGTTTATTAAAAATGACAT
 
. : . : . : . : . : . :
rJMSF033O14- TCATGAATTTCTTC
rJMSF024D04- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
rJMFF035B03- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGN
rJMSF011G08- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCANNA-ANAGTTGGC
rJMSF019F13- TCATGAATTTCTTCACCTTANGACTTGCATCTTCTCCAAAGACATCAAAANAGAGNTGGC
rJMFF023N23- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
rJMSF014P04- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
rJMSF021L23- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
rJMSF021F08- TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
                      ____________________________________________________________
consensus TCATGAATTTCTTCACCTTAGGACTTGCATCTTCTCCAAAGACATCAAAA-AGAGTTGGC
 
. : . : . : . : . : . :
rJMSF024D04- CTAACATTCCCAACATCAATATCATCCTTACCAGTCTGTTGCTTAAGAATGTCAATA
rJMFF035B03- CTAACATTCCCAACATCAATATCATCCTTACC
rJMSF011G08- CTAACATTCCCANCATCAATATCATCCTTACCAGTCTGNTGCTTAAGA
rJMSF019F13- CTAACATTCCCAACATCAATATCATCCTTACCANTCTGTTGCTTAA
rJMFF023N23- CTAACATTCCCAACATCAATATCATCCTTACCAGTCTGTTGCTTAAGAATGTCAATAAGG
rJMSF014P04- CTAACATTCCCAACATCAATATCATCCTT---AGTCTGTTGCTTAAGAATGTCAATAAGG
rJMSF021L23- CTAACATTCCCAACATCAATATCATCCTTACCAGTCTGTTGCTTAAGAATGTCAATAAGG
rJMSF021F08- CTAACATTCCCAACATCAATATCATCCTT---AGTCTGTTGCTTAAGAATGTCAATAAGG
                      ____________________________________________________________
consensus CTAACATTCCCAACATCAATATCATCCTTACCAGTCTGTTGCTTAAGAATGTCAATAAGG
 
. : . : . : . : . : . :
rJMFF023N23- G
rJMSF014P04- GTGGATAAAGGCAAGGATCTGCTCTTGACATGGGTTTGATCCCCATATTCTGATTC
rJMSF021L23- G
rJMSF021F08- GTGGATAAAGGCAAGGATCTGCTCTTGACATGGGTTTGATCCCCATATTCTGATTCANTC
JMSF021L23+ GATTCAATC
JMSF021F08+ GATTCAATC
                      ____________________________________________________________
consensus GTGGATAAAGGCAAGGATCTGCTCTTGACATGGGTTTGATCCCCATATTCTGATTCAATC
 
. : . : . : . : . : . :
rJMSF021F08- ACTATTTCTCTCTCAGTCTCACTATCGTGTTCATGATGGTGATGAAATCCTG
JMSF021L23+ ACTATTTCTCTCTCAGTCTCACTATCGTGTTCATGATGGTGATGAAATCCTGGGAGGTGA
JMSF021F08+ ACTATTTCTCTCTCAGTCTCACTATCGTGTTCATGATGGTGATGAAATCCTGGGAGGTGA
                      ____________________________________________________________
consensus ACTATTTCTCTCTCAGTCTCACTATCGTGTTCATGATGGTGATGAAATCCTGGGAGGTGA
 
. : . : . : . : . : . :
JMSF021L23+ ATGCCACGAGACTCAGCTTTCCCACGCAAGAATTTCCTGAATCCAAATCGAGATGATCCA
JMSF024D04+ ACGCAAGAATTTCCTGAATCCAAATCGAGATGATCCA
JMSF021F08+ ATGCCACGAGACTCAGCTTTCCCACGCAAGAATTTCCTGAATCCAAATCGAGATGATCCA
JMSF033O14+ ACGCAAGAATTTCCTGAATCCAAATCGAGATGATCCA
                      ____________________________________________________________
consensus ATGCCACGAGACTCAGCTTTCCCACGCAAGAATTTCCTGAATCCAAATCGAGATGATCCA
 
. : . : . : . : . : . :
JMSF021L23+ CCACCATCCTCATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
JMSF024D04+ CCACCATCCTCATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
JMFF002E05+ CATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
JMSF021F08+ CCACCATCCTCATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
JMSF033O14+ CCACCATCCTCATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
                      ____________________________________________________________
consensus CCACCATCCTCATCAGCATCATCAGCATCAGCATTGTCATGGGTACTCTCTCCAATCTGC
 
. : . : . : . : . : . :
JMSF021L23+ TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
JMSF024D04+ TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
JMFF002E05+ TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
JMSF021F08+ TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
JMSF014P04+ TTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
JMSF033O14+ TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
                      ____________________________________________________________
consensus TCCTTGGCTTTATCAATAAGCCCACCACTATGGCATGAATCAGATACTATTGTTAGTCGG
 
. : . : . : . : . : . :
JMSF021L23+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMSF024D04+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMFF002E05+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMSF021F08+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMFF035B03+ GCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMSF014P04+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMFF023N23+ GGCAAGGAGTCCCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
JMSF011G08+ ATCATCGGTGATAAGANTGAA
JMSF033O14+ CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
                      ____________________________________________________________
consensus CAACCTTGCGGCAAGGAGT-CCACCAGCTCTCTAAAATCATCATCGGTGATAAGATTGAA
 
. : . : . : . : . : . :
JMSF021L23+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMSF024D04+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMFF002E05+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMSF021F08+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMFF035B03+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMSF014P04+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMFF023N23+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMSF011G08+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
JMSF033O14+ ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
                      ____________________________________________________________
consensus ATCAGAAGGGACGATGCACTCATCGAAGCCGGTGTCGTCTTCCTCGCCGGTCTCGGCCGG
 
. : . : . : . : . : . :
JMSF021L23+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMSF024D04+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMFF002E05+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMSF021F08+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMFF035B03+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMSF014P04+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMFF023N23+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMSF011G08+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
JMSF033O14+ AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
                      ____________________________________________________________
consensus AAGGCGGGTACCGTGGCCGCTATAGTGGACAAAAAGGTAGTCGCCGGAGCCGGCGGATTT
 
. : . : . : . : . : . :
JMSF021L23+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMSF024D04+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMFF002E05+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMSF021F08+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMFF035B03+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMSF014P04+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMFF023N23+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMSF011G08+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
JMSF033O14+ GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
                      ____________________________________________________________
consensus GACGAGATCGGAGAGAGCGCTGCGGATGTTGCGGCCCGTAGGCTGGGTGTAGGAAGCGTC
 
. : . : . : . : . : . :
JMSF021L23+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMSF024D04+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMFF002E05+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMSF021F08+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMFF035B03+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMSF014P04+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMFF023N23+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMSF011G08+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
JMSF033O14+ GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
                      ____________________________________________________________
consensus GGTGTCGATGAGGACGGTGATGTCGTCCTCGGAGAAGCCGTAACGGTCGACGAGGCAGCG
 
. : . : . : . : . : . :
JMSF021L23+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMSF024D04+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMFF002E05+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMSF021F08+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMFF035B03+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMSF014P04+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMFF023N23+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMSF011G08+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
JMSF033O14+ GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
                      ____________________________________________________________
consensus GTGCATTCGCCGGACGTCATTGACGCAGCCTTTGAGCTCGGCTTTGGTGCCAGGATAGTT
 
. : . : . : . : . : . :
JMSF021L23+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMSF024D04+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMFF002E05+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCC
JMSF021F08+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMFF035B03+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMSF014P04+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMFF023N23+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMSF011G08+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
JMSF033O14+ GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
                      ____________________________________________________________
consensus GATTCCGATCAACACTGCTTTCCTCGCCATTTCTCTCCCGCTCGATCTGAATCTGCAGCG
 
. : . : . : . : . : . :
JMSF021L23+ ATCAGTACCGTTTATCAC
JMSF024D04+ ATCAGTACCGTTTATCACGCAC
JMSF021F08+ ATCAGTACCGTTTATCACGCAC
JMFF035B03+ ATCAGTACCGTTTATCACGC
JMSF014P04+ ATCAGTACCGTTTATCACGCAC
JMFF023N23+ ATCAGTACCGTTTATCACGC
JMSF011G08+ ATCAGTACCGTTTATCACGC
JMSF033O14+ ATCAGTACCGTTTATCACGCACGTTCACGACTCGATCAATCAATCAGTATATACTCCCTC
                      ____________________________________________________________
consensus ATCAGTACCGTTTATCACGCACGTTCACGACTCGATCAATCAATCAGTATATACTCCCTC