Previous Contig 006908:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007G03Sequence534006908 (2)
JMSF033M19Sequence722006908 (2)gb:AY115844_15789344e-34Medicago truncatula auxin influx carrier protein (LAX4) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033M19+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
JMSF033M19+ ATGAGGTACGCCGTCCAGCTTCCGACGATGCCGTAGAAGATTTGGANCACTATGCCCGAC
                      ____________________________________________________________
consensus ATGAGGTACGCCGTCCAGCTTCCGACGATGCCGTAGAAGATTTGGANCACTATGCCCGAC
 
. : . : . : . : . : . :
JMSF033M19+ ACCATGCCCAGCTGGGAAAATGAGTATGGGAGTGTCAAGAGAACCTGCGCCACTTGATTG
                      ____________________________________________________________
consensus ACCATGCCCAGCTGGGAAAATGAGTATGGGAGTGTCAAGAGAACCTGCGCCACTTGATTG
 
. : . : . : . : . : . :
JMFS007G03+ AGGAAGTTCTTCACA
JMSF033M19+ GAAGCGCAACTGAACCAAGCATCCCAGGAAGAGCCGCCATGCCAGAGGAAGTTCTTCACA
                      ____________________________________________________________
consensus GAAGCGCAACTGAACCAAGCATCCCAGGAAGAGCCGCCATGCCAGAGGAAGTTCTTCACA
 
. : . : . : . : . : . :
JMFS007G03+ CTGAAAAGCGACTGATCTTCTTCTTCTCCTCCTCCTCTCTCAGTTCCTTCTTCTTTGCTG
JMSF033M19+ CTGAAAAGCGACTGATCTTCTTCTTCTCCTCCTCCTCTCTCAGTTCCTTCTTCTTTGCTG
                      ____________________________________________________________
consensus CTGAAAAGCGACTGATCTTCTTCTTCTCCTCCTCCTCTCTCAGTTCCTTCTTCTTTGCTG
 
. : . : . : . : . : . :
JMFS007G03+ CCTCCTTCTTGCTCTGCTTCACTGAAGTTTGGGACAATTGCTTCTTCTGCTTGCTTCTGA
JMSF033M19+ CCTCCTTCTTGCTCTGCTTCACTGAAGTTTGGGACAATTGCTTCTTCTGCTTGCTTCTGA
                      ____________________________________________________________
consensus CCTCCTTCTTGCTCTGCTTCACTGAAGTTTGGGACAATTGCTTCTTCTGCTTGCTTCTGA
 
. : . : . : . : . : . :
JMFS007G03+ GACAACATTGTGGGAAATTCTGTGTTCGGGCAGATCTTGTTTCTGAGTTCAACCCAGATC
JMSF033M19+ GACAACATTGTGGGAAATTCTGTGTTCGGGCAGATCTTGTTTCTGAGTTCAACCCAGATC
                      ____________________________________________________________
consensus GACAACATTGTGGGAAATTCTGTGTTCGGGCAGATCTTGTTTCTGAGTTCAACCCAGATC
 
. : . : . : . : . : . :
JMFS007G03+ TCTGATTGATTCAGGACTCTGTTTCTTCTTTTTATTTCTTTTCAGGAAAGAATCAATATA
JMSF033M19+ TCTGATTGATTCAGGACTCTGTTTCTTCTTTTTATTTCTTTTCAGGAAAGAATCAATATA
                      ____________________________________________________________
consensus TCTGATTGATTCAGGACTCTGTTTCTTCTTTTTATTTCTTTTCAGGAAAGAATCAATATA
 
. : . : . : . : . : . :
JMFS007G03+ TCATAGAAACAAGATATATATCTCTGTAAACAAGCGATTCAAGAGTTGTTTCCAGGGTTT
JMSF033M19+ TCATAGAAACAAGATATATATCTCTGTAAAAAAGCGATTCAAGAGTTGTTTCCAGGGTTT
                      ____________________________________________________________
consensus TCATAGAAACAAGATATATATCTCTGTAAACAAGCGATTCAAGAGTTGTTTCCAGGGTTT
 
. : . : . : . : . : . :
JMFS007G03+ TGACGAGTGTTAAGTGAAAGAAATCTTTGAAACCACAACTCAGCTTAAATGCGGGAATTT
JMSF033M19+ TGACGAGTGTTAAGTGAAAGAAATCTTTGAAACCACAACTCAGCTTAAATGCGGGAATTT
                      ____________________________________________________________
consensus TGACGAGTGTTAAGTGAAAGAAATCTTTGAAACCACAACTCAGCTTAAATGCGGGAATTT
 
. : . : . : . : . : . :
JMFS007G03+ GATTATATATTTGTATATACAGAGGATAAAGAAATTAAATTAGCATAGAGAGAGATATGA
JMSF033M19+ GATTATATATTTGTATATACAGAGGATAAAGAAATTAAATTAGCATAGAGAGAGATATGA
                      ____________________________________________________________
consensus GATTATATATTTGTATATACAGAGGATAAAGAAATTAAATTAGCATAGAGAGAGATATGA
 
. : . : . : . : . : . :
JMFS007G03+ TAAAGTGTTTTTCTTCTTCTTCTTCTTTATGTAGCAAAGAGAGACAGAGAAAGAGCAAAA
JMSF033M19+ TAAAGTGTTTTTCTTCTTCTTCTTCTTTATGTAGCAAAGAGAGACAGAGAAAGAGCAAAA
                      ____________________________________________________________
consensus TAAAGTGTTTTTCTTCTTCTTCTTCTTTATGTAGCAAAGAGAGACAGAGAAAGAGCAAAA
 
. : . : . : . : . : . :
JMFS007G03+ CCCAAGTTCTCTGTTCTGTTCTTGGTACCTAGTACTAAC
JMSF033M19+ CCCAAGTTCTCTGTTCTGTTCTTGGTACCTAGTACTAACGCTACAGAAGAAAAGAATTCC
                      ____________________________________________________________
consensus CCCAAGTTCTCTGTTCTGTTCTTGGTACCTAGTACTAACGCTACAGAAGAAAAGAATTCC