Previous Contig 006902:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013B04Sequence586006902 (3)gb:AF512549_18072941e-72Lycopersicon esculentum alkaline alpha-galactosidase seed imbibition protein (SI
JMSF033L11Sequence620006902 (3)gb:AF512549_18072941e-72Lycopersicon esculentum alkaline alpha-galactosidase seed imbibition protein (SI742013224 (4)gb:AF512549_18072941e-90Lycopersicon esculentum alkaline alpha-galactosidase seed imbibition protein (SI
JMSF034M23Sequence590006902 (3)gb:AF512549_18072945e-78Lycopersicon esculentum alkaline alpha-galactosidase seed imbibition protein (SI592013224 (4)gb:AF512549_18072942e-62Lycopersicon esculentum alkaline alpha-galactosidase seed imbibition protein (SI

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034M23+ CTTTCACGGTGACAAAATGTCT
JMSF033L11+ TTTCACGGTGACAAAATGTCT
                      ____________________________________________________________
consensus CTTTCACGGTGACAAAATGTCT
 
. : . : . : . : . : . :
JMSF034M23+ GCATATGACTCTCCACAGCCTTGACTGCATCGGTGATGACATCAAAGGGGTTTGATCCAG
JMFS013B04+ GCATATGACTCTCCACAGCCTTGACTGCATCGGTGATGACATCAAGGGGGTTTGATCCAG
JMSF033L11+ GCATATGACTCTCCACAGCCTTGACTGCATCGGTGATGACATCAAAGGGGTTTGATCCAG
                      ____________________________________________________________
consensus GCATATGACTCTCCACAGCCTTGACTGCATCGGTGATGACATCAAAGGGGTTTGATCCAG
 
. : . : . : . : . : . :
JMSF034M23+ CAGCCACAAAAACCAGGTGGCTCCCTTGGAATTCTTCCACAGCAGGATCTCCACTTTCCA
JMFS013B04+ CAGCCACAAAAACCAGGTGGCTCCCTTGGAATTCTTCCACAGCAGGATCTCCACTTTCCA
JMSF033L11+ CAGCCACAAAAA-CAGGTGGCTCCCTTGGAATTCTTCCACAGCAGGATCTCCACTTTCCA
                      ____________________________________________________________
consensus CAGCCACAAAAACCAGGTGGCTCCCTTGGAATTCTTCCACAGCAGGATCTCCACTTTCCA
 
. : . : . : . : . : . :
JMSF034M23+ GGCATATCTCCAACTCATTGTCAGCATTCCCTTGAATAACAGCTCTAAAATTGCCTTCCA
JMFS013B04+ GGCATATCTCCAACTCATTGTCAGCATTCCCTTGAATAACAGCTCTAAAATTGCCTTCCA
JMSF033L11+ GGCATATCTCCAACTCATTGTCAGCATTCCCTTGAATAACAGCTCTAAAATTGCCTTCCA
                      ____________________________________________________________
consensus GGCATATCTCCAACTCATTGTCAGCATTCCCTTGAATAACAGCTCTAAAATTGCCTTCCA
 
. : . : . : . : . : . :
JMSF034M23+ GAATAGGCAGGAACACAACATACAACGCTGAACCTTCATCTGTTTCTTCAAAGTGTGAAG
JMFS013B04+ GAATAGGCAGGAACACAACATACAACGCTGAACCTTCATCTGTTTCTTCAAAGTGTGAAG
JMSF033L11+ GAATAGGCAGGAACACAACATACAACGCTGAACCTTCATCTGTTTCTTCAAAGTGTGAAG
                      ____________________________________________________________
consensus GAATAGGCAGGAACACAACATACAACGCTGAACCTTCATCTGTTTCTTCAAAGTGTGAAG
 
. : . : . : . : . : . :
JMSF034M23+ CATCATGTCCTTCCACAATCATAAACTGTGTCTCAAATGGTATGTCTTGCCCACAGGTCC
JMFS013B04+ CATCATGTCCTTCCACAATCATAAACTGTGTCTCAAATGGTATGTCTTGCCCACAGGTCC
JMSF033L11+ CATCATGTCCTTCCACAATCATAAACTGTGTCTCAAATGGTATGTCTTGCCCACAGGTCC
                      ____________________________________________________________
consensus CATCATGTCCTTCCACAATCATAAACTGTGTCTCAAATGGTATGTCTTGCCCACAGGTCC
 
. : . : . : . : . : . :
JMSF034M23+ CCATTCTCTGTGTCATCCACCACATCTTGAACCGAAAGGAACACATAAACCGCAACCCCT
JMFS013B04+ CCATTCTCTGTGTCATCCACCACATCTTGAACCGAAAGGAACACATAAACCGCAACCCCT
JMSF033L11+ CCATTCTCTGTGTCATCCACCACATCTTGAACCGAAAGGAACACATAAACCGCAACCCCT
                      ____________________________________________________________
consensus CCATTCTCTGTGTCATCCACCACATCTTGAACCGAAAGGAACACATAAACCGCAACCCCT
 
. : . : . : . : . : . :
JMSF034M23+ CGAGCTTTCCAACAGGGAATACTCTGCGGCTTCCAACCCCGTCAGATTGAACACCGAGGA
JMFS013B04+ CGAGCTTTCCAACAGGGAATACTCTGCGGCTTCCAACCCCGTCAGATTGAACACCGAGGA
JMSF033L11+ CGAGCTTTCCAACAGGGAATACTCTGCGGCTTCCAACCCCGTCAGATTGAACACCGAGGA
                      ____________________________________________________________
consensus CGAGCTTTCCAACAGGGAATACTCTGCGGCTTCCAACCCCGTCAGATTGAACACCGAGGA
 
. : . : . : . : . : . :
JMSF034M23+ AAGCGCCATTGATAAGAACCTCGCCGGTTGCCGGAGTTAATATGATGTTGTCGTGAACAT
JMFS013B04+ AAGCGCCATTGATAAGAACCTCGCCGGTTGCCGGAGTTAATATGATGTTGTCGTGAACAT
JMSF033L11+ AAGCGCCATTGATAAGAACCTCGCCGGTTGCCGGAGTTAATATGATGTTGTCGTGAACAT
                      ____________________________________________________________
consensus AAGCGCCATTGATAAGAACCTCGCCGGTTGCCGGAGTTAATATGATGTTGTCGTGAACAT
 
. : . : . : . : . : . :
JMSF034M23+ TGCTCAGAATGCACTTCCCCAGAACATTCAAGTTCCCATCAGCCACCGTTATCCCTGCCC
JMFS013B04+ TGCTCAGAATGCACTTCCCCAGAACATTCAAGTTCCCATCAGCCACCGTTATCCCTGCCC
JMSF033L11+ TGCTCAGAATGCACTTCCCCAGAACATTCAAGTTCCCATCAGCCACCGTTATCCCTGCCC
                      ____________________________________________________________
consensus TGCTCAGAATGCACTTCCCCAGAACATTCAAGTTCCCATCAGCCACCGTTATCCCTGCCC
 
. : . : . : . : . : . :
JMSF034M23+ CAACCGTCATCTTCTTCACCACAAC
JMFS013B04+ CAACCGTCATCTTCTTCACCACAACCTATCTATCAACAATAGAGAA
JMSF033L11+ CAACCGTCATCTTCTTCACCACAACCTATCTATCAACAATAGAGAAGTGTCCTTTTCTCC
                      ____________________________________________________________
consensus CAACCGTCATCTTCTTCACCACAACCTATCTATCAACAATAGAGAAGTGTCCTTTTCTCC