Previous Contig 006900:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033L08Sequence689006900 (2)gb:AP003282_18272274e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058744023586gb:AP003282_18272273e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058
JMSF049P15Sequence658006900 (2)gb:AP003282_18272273e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058763024397gb:AP003282_18272274e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049P15+ CCAGTTTTCACTCCGTGCAGATATCCTT
                      ____________________________________________________________
consensus CCAGTTTTCACTCCGTGCAGATATCCTT
 
. : . : . : . : . : . :
JMSF049P15+ TACCAGAGAGAGCTATATGCAAACCTTGCTCCTCATCCATCCGTATACAATCACTGAAAT
JMSF033L08+ CTCATCCATCNGTATACAATCACTGAAAT
                      ____________________________________________________________
consensus TACCAGAGAGAGCTATATGCAAACCTTGCTCCTCATCCATCCGTATACAATCACTGAAAT
 
. : . : . : . : . : . :
JMSF049P15+ TGTTTGTTGTTTTGTAATGGAGGTAGCACCCATAAATAGAAAACAGTGATCCAAACAGAA
JMSF033L08+ TGTTTGTTGTTTTGTAATGGAGGTAGCACCCATAAATAGAAAACAGTGATCCAAACAGAA
                      ____________________________________________________________
consensus TGTTTGTTGTTTTGTAATGGAGGTAGCACCCATAAATAGAAAACAGTGATCCAAACAGAA
 
. : . : . : . : . : . :
JMSF049P15+ AGTAAATGGTAACCAACATAAATGTCCACTGAGTATAATAGAAAAACAGGTCAGCACCAT
JMSF033L08+ AGTAAATGGTAACCAACATAAATGTCCACTGAGTATAATAGAAAAACAGGTCAGCACCAT
                      ____________________________________________________________
consensus AGTAAATGGTAACCAACATAAATGTCCACTGAGTATAATAGAAAAACAGGTCAGCACCAT
 
. : . : . : . : . : . :
JMSF049P15+ GAACAACGACATCAGCAGTAAGTGCTGCTGCCAGTAAAATAAATGCAACTAATCGGAAAA
JMSF033L08+ GAACAACGACATCAGCAGTAAGTGCTGCTGCCAGTAAAATAAATGCAACTAATCGGAAAA
                      ____________________________________________________________
consensus GAACAACGACATCAGCAGTAAGTGCTGCTGCCAGTAAAATAAATGCAACTAATCGGAAAA
 
. : . : . : . : . : . :
JMSF049P15+ CCATCAAAATAACTGGGTGTAATTCTTTCACACATGGTCTCCAAGCCTCATCAAACCAGA
JMSF033L08+ CCATCAAAATAACTGGGTGTAATTCTTTCACACATGGTCTCCAAGCCTCATCAAACCAGA
                      ____________________________________________________________
consensus CCATCAAAATAACTGGGTGTAATTCTTTCACACATGGTCTCCAAGCCTCATCAAACCAGA
 
. : . : . : . : . : . :
JMSF049P15+ AAAGCCAAGATTTCTCTTGCCACTTATCCCTTCCATCGGATTCAGAATTGTCCCCTGCTG
JMSF033L08+ AAAGCCAAGATTTCTCTTGCCACTTATCCCTTCCATCGGATTCAGAATTGTCCCCTGCTG
                      ____________________________________________________________
consensus AAAGCCAAGATTTCTCTTGCCACTTATCCCTTCCATCGGATTCAGAATTGTCCCCTGCTG
 
. : . : . : . : . : . :
JMSF049P15+ AAGATTCATATTTCCATATTAAAACTAGTCCTAAAACTATGGACGTCAAGACCCATGTTG
JMSF033L08+ AAGATTCATATTTCCATATTAAAACTAGTCCTAAAACTATGGACGTCAAGACCCATGTTG
                      ____________________________________________________________
consensus AAGATTCATATTTCCATATTAAAACTAGTCCTAAAACTATGGACGTCAAGACCCATGTTG
 
. : . : . : . : . : . :
JMSF049P15+ CACAGAGCACAGCCCTCCAATTCCACCAATAACTTAGGGTAGTACTGTCAGCAGCCACCA
JMSF033L08+ CACAGAGCACAGCCCTCCAATTCCACCAATAACTTAGGGTAGTACTGTCAGCAGCCACCA
                      ____________________________________________________________
consensus CACAGAGCACAGCCCTCCAATTCCACCAATAACTTAGGGTAGTACTGTCAGCAGCCACCA
 
. : . : . : . : . : . :
JMSF049P15+ TGAGTTGTTGCATCCTGTCGAAGATGCAACCTTACTCTCACTTCCTTAGTCTGATCTCAG
JMSF033L08+ TGAGTTGTTGCATCCTGTCGAAGATGCAACCTTACTTTCACTTCCTTAGTCTGATCTCAG
                      ____________________________________________________________
consensus TGAGTTGTTGCATCCTGTCGAAGATGCAACCTTACTTTCACTTCCTTAGTCTGATCTCAG
 
. : . : . : . : . : . :
JMSF049P15+ AATCACAATGACCGGACTGCAGAGGATGGCGAAGCTGTGCGTGGTGGCGCCGCCGCCGGG
JMSF033L08+ AATCACAATGACCGGACTGCAGAGGATGGCGAAGCTGTGCGTGGTGGCGCCGCCGCCGGG
                      ____________________________________________________________
consensus AATCACAATGACCGGACTGCAGAGGATGGCGAAGCTGTGCGTGGTGGCGCCGCCGCCGGG
 
. : . : . : . : . : . :
JMSF049P15+ GAATGGGGGACGACTTTGTGCGTTGGAAC
JMSF033L08+ GAATGGGGGACGACTTTGTGCGTTGGAACAGGTAAAAATGTTTTCCTCGTTTATTATTTC
                      ____________________________________________________________
consensus GAATGGGGGACGACTTTGTGCGTTGGAACAGGTAAAAATGTTTTCCTCGTTTATTATTTC
 
. : . : . : . : . : . :
JMSF033L08+ TTATTATTATTGCAACAGTTGAAGAAGAAGAGGAAGCGTCTGGTTTATTCCGTTCTATCA
                      ____________________________________________________________
consensus TTATTATTATTGCAACAGTTGAAGAAGAAGAGGAAGCGTCTGGTTTATTCCGTTCTATCA