Previous Contig 006895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033K13Sequence626006895 (2)gb:BT002029_16356324e-70Arabidopsis thaliana unknown protein (At1g04620) mRNA, complete cds.>gb:BT006603671013401 (2)gb:BT002029_16356325e-69Arabidopsis thaliana unknown protein (At1g04620) mRNA, complete cds.>gb:BT006603
JMSF042D22Sequence756006895 (2)gb:BT002029_1635632e-108Arabidopsis thaliana unknown protein (At1g04620) mRNA, complete cds.>gb:BT006603777013401 (2)gb:BT002029_16356324e-59Arabidopsis thaliana unknown protein (At1g04620) mRNA, complete cds.>gb:BT006603

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042D22+ TTATCGAGCCCTTTCTCGCGTTCCATTATCCACACAATTAGT
                      ____________________________________________________________
consensus TTATCGAGCCCTTTCTCGCGTTCCATTATCCACACAATTAGT
 
. : . : . : . : . : . :
JMSF042D22+ GCCTAAAACATAAAGTTTTTCCAAACCCAAATAGTGCTCGACCGATCTTAAAGCTTGTAC
                      ____________________________________________________________
consensus GCCTAAAACATAAAGTTTTTCCAAACCCAAATAGTGCTCGACCGATCTTAAAGCTTGTAC
 
. : . : . : . : . : . :
JMSF042D22+ TTGGCAACCAACACCACAAAACAGAAGTCGCTTCACACCAGCAGCCTCAACTAAAGCAAG
                      ____________________________________________________________
consensus TTGGCAACCAACACCACAAAACAGAAGTCGCTTCACACCAGCAGCCTCAACTAAAGCAAG
 
. : . : . : . : . : . :
JMSF042D22+ AGTATTCAAATTAGGAGACAGTGTTGGCTTGACGCCTTTAGCTGCTAGTACTTCCTCTGG
                      ____________________________________________________________
consensus AGTATTCAAATTAGGAGACAGTGTTGGCTTGACGCCTTTAGCTGCTAGTACTTCCTCTGG
 
. : . : . : . : . : . :
JMSF042D22+ TGTCCTCGCTAAGACAGGTCGAGGAGCAAATCTATCTTCCGGATCACTCTGCACACATAT
JMSF033K13+ CCTCGCTAAGACAGGTCGAGGAGCAAATCTATCTTCCGGATCACTCTGCACACATAT
                      ____________________________________________________________
consensus TGTCCTCGCTAAGACAGGTCGAGGAGCAAATCTATCTTCCGGATCACTCTGCACACATAT
 
. : . : . : . : . : . :
JMSF042D22+ AACAGCTTCCACCATACCAGTTTTCAGCATCTCTATTGCGATTGTTGTCACTATGCCTGT
JMSF033K13+ AACAGCTTCCACCATACCAGTTTTCAGCATCTCTATTGCGATTGTTGTCACTATGCCTGT
                      ____________________________________________________________
consensus AACAGCTTCCACCATACCAGTTTTCAGCATCTCTATTGCGATTGTTGTCACTATGCCTGT
 
. : . : . : . : . : . :
JMSF042D22+ CCATTGAGCTCCTTCCAAAGGCTTAGTTTTGCGAGCATACAATAATTCCTCATGGACACC
JMSF033K13+ CCATTGAGCTCCTTCCAAAGGCTTAGTTTTGCGAGCATACAATAATTCCTCATGGACACC
                      ____________________________________________________________
consensus CCATTGAGCTCCTTCCAAAGGCTTAGTTTTGCGAGCATACAATAATTCCTCATGGACACC
 
. : . : . : . : . : . :
JMSF042D22+ CATATAAGTCTCATCCAATGAATCAACTTTCCTTCCTCTGCCATGTACAACAGGTTCCAA
JMSF033K13+ CATATAAGTCTCATCCAATGAATCAACTTTCCTTCCTCTGCCATGTACAACAGGTTCCAA
                      ____________________________________________________________
consensus CATATAAGTCTCATCCAATGAATCAACTTTCCTTCCTCTGCCATGTACAACAGGTTCCAA
 
. : . : . : . : . : . :
JMSF042D22+ GGCCTCAATTCTAGACATGCCATCCCCCAAGAAAGCACAAGCATTTTTAACATGGGCTAT
JMSF033K13+ GGCCTCAATTCTAGACATGCCATCCCCCAAGAAAGCACAAGCATTTTTAACATGGGCTAT
                      ____________________________________________________________
consensus GGCCTCAATTCTAGACATGCCATCCCCCAAGAAAGCACAAGCATTTTTAACATGGGCTAT
 
. : . : . : . : . : . :
JMSF042D22+ GTAATAAGTATCACACAACCCGCAATGGCTGCAGTGGTCCTTAGCTGGGTAGGTCCCACC
JMSF033K13+ GTAATAAGTATCACACAACCCGCAATGGCTGCAGTGGTCCTTAGCTGGGTAGGTCCCACC
                      ____________________________________________________________
consensus GTAATAAGTATCACACAACCCGCAATGGCTGCAGTGGTCCTTAGCTGGGTAGGTCCCACC
 
. : . : . : . : . : . :
JMSF042D22+ AGGAGGAATGGGTTTGGATTTCTGCCTCCAATCTTCTCTGAGCTTCAATGGTTTTGGGTT
JMSF033K13+ AGGAGGAATGGGTTTGGATTTCTGCCTCCAATCTTCTCTGAGCTTCAATGGTTTTGGGTT
                      ____________________________________________________________
consensus AGGAGGAATGGGTTTGGATTTCTGCCTCCAATCTTCTCTGAGCTTCAATGGTTTTGGGTT
 
. : . : . : . : . : . :
JMSF042D22+ TGTGTTTGCTTCTTTAGATGCAGAGACAATAGAGAAGGTGAAAGGCGAAGGAGAGAGCTT
JMSF033K13+ TGTGTTTGCTTCTTTAGATGCAGAGACAATAGAGAAGGTGAAAGGCGAAGGAGAGAGCTT
                      ____________________________________________________________
consensus TGTGTTTGCTTCTTTAGATGCAGAGACAATAGAGAAGGTGAAAGGCGAAGGAGAGAGCTT
 
. : . : . : . : . : . :
JMSF042D22+ TGCACTGAGAAGAGCCATGGCTTCCACATCAACTGCCAACTGAGAGTTTCACT
JMSF033K13+ TGCACTGAGAAGAGCCATGGCTTCCACATCAACTGCCAACTGAGAGTTTCACTGTCTTAC
                      ____________________________________________________________
consensus TGCACTGAGAAGAGCCATGGCTTCCACATCAACTGCCAACTGAGAGTTTCACTGTCTTAC