Previous Contig 006888:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005B11Sequence528006888 (3)
JMFS155D09Sequence583006888 (3)
JMSF033J04Sequence484006888 (3)730005248 (8)gb:ATH575583_15529037e-16Arabidopsis thaliana mRNA for origin recognition complex 5 subunit (orc5 gene),

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS155D09+ GTTAGGCCGGGGCG
                      ____________________________________________________________
consensus GTTAGGCCGGGGCG
 
. : . : . : . : . : . :
JMFS005B11+ TGAATTCAATTCCCCATTCCCCGT
JMFS155D09+ GGGCAGGAAATGGGTCCTGTNCCGTCCCCCCGTCCCTGAATTCAATT-CCCATTCCCCGT
                      ____________________________________________________________
consensus GGGCAGGAAATGGGTCCTGTNCCGTCCCCCCGTCCCTGAATTCAATTCCCCATTCCCCGT
 
. : . : . : . : . : . :
JMFS005B11+ CTCGGCCAGTTGGGGATTGGGAATTACCCCCATCCCGGGGATTTTCCGGGACTGAGATTC
JMFS155D09+ CTCGGCCAGTTGGGGATTGGGAATTACCCCCATCCCGGGGATTTTCCGGGACTGAGATTC
                      ____________________________________________________________
consensus CTCGGCCAGTTGGGGATTGGGAATTACCCCCATCCCGGGGATTTTCCGGGACTGAGATTC
 
. : . : . : . : . : . :
JMFS005B11+ NCCGCCCTTTTTAGATAGAGTGTAAAATAATATATACAATTTTAATTATTTAATTAGTTT
JMFS155D09+ CCCGCCCTTTTTAGATAGAGTGTAAAATAATATATACAATTTTAATTATTTAATTAGTTT
JMSF033J04+ ATTTTAATTATTTAATTAGTTT
                      ____________________________________________________________
consensus CCCGCCCTTTTTAGATAGAGTGTAAAATAATATATACAATTTTAATTATTTAATTAGTTT
 
. : . : . : . : . : . :
JMFS005B11+ TTAATTTGATATATTTAAATCTTGAATTACTAGAAATTATAACTTCCGCAATGAGGATGG
JMFS155D09+ TTAATTTGATATATTTAAATCTTGAATTACTAGAAATTATAACTTCCGCAATGAGGATGG
JMSF033J04+ TTAATTTGATATATTTAAATNTTGAATTNCTNGAAATTNTAACTTNCNCNATGNGGATGG
                      ____________________________________________________________
consensus TTAATTTGATATATTTAAATCTTGAATTACTAGAAATTATAACTTCCGCAATGAGGATGG
 
. : . : . : . : . : . :
JMFS005B11+ CCCCCTGAATTTGGTGGAACATGTAAGCCAAATACAAATTTAAGCATTCAATTTAGGACT
JMFS155D09+ CCCCCTGAATTTGGTGGAACATGTAAGCCAAATACAAATTTAAGCATTCAATTTAGGACT
JMSF033J04+ CCCCCTGAATTTGGTGGAACNTNTNAGCCAAATNCAAATTTNAGCCTTCAATTTNGGNCT
                      ____________________________________________________________
consensus CCCCCTGAATTTGGTGGAACATGTAAGCCAAATACAAATTTAAGCATTCAATTTAGGACT
 
. : . : . : . : . : . :
JMFS005B11+ GGGAGGTATGGAACAGAGATGCAGTGCTACAGCGCAGTAAAATCCAAGGAATAGAGAGAA
JMFS155D09+ GGGAGGTATGGAACAGAGATGCAGTGCTACAGCGCAGTAAAATCCAAGGAATAGAGAGAA
JMSF033J04+ GGGAGGTNTGGAACAGAGATGCNGTGCTNCAGCNCNGTNAAATNCNAGGAATNGNGNGAA
                      ____________________________________________________________
consensus GGGAGGTATGGAACAGAGATGCAGTGCTACAGCGCAGTAAAATCCAAGGAATAGAGAGAA
 
. : . : . : . : . : . :
JMFS005B11+ AAAAAAAAGGGCAAACTGGAAATGAATGAAAAGAAGCAAACAAAGCAAACACAGGCAGTG
JMFS155D09+ AAAAAAAAGGGCAAACTGGAAATGAATGAAAAGAAGCAAACAAAGCAAACACAGGCAGTG
JMSF033J04+ AAAAAAAAGGGCAAACTGGAAATGAATGAAAAGAAGCAAACAAAGCAAACACAGGCAGTG
                      ____________________________________________________________
consensus AAAAAAAAGGGCAAACTGGAAATGAATGAAAAGAAGCAAACAAAGCAAACACAGGCAGTG
 
. : . : . : . : . : . :
JMFS005B11+ ACTACAAACTCATAAAGCTAACCCGGTACTCTGGCTGCTGGCAACGGAGGGCGTGAGACA
JMFS155D09+ ACTACAAACTCATAAAGCTAACCCGGTACTCTGGCTGCTGGCAACGGAGGGCGTGAGACA
JMSF033J04+ ACTACAAACTCATAAAGCTAACCCGGTACTCTGGCTGCTGGCAACGGAGGGCGTGAGACA
                      ____________________________________________________________
consensus ACTACAAACTCATAAAGCTAACCCGGTACTCTGGCTGCTGGCAACGGAGGGCGTGAGACA
 
. : . : . : . : . : . :
JMFS005B11+ CAGAGGCACTGACAGTGAAGAACCAGCGCCTAGCGAAGTTGGCTTGATTGCTGGAACCAG
JMFS155D09+ CAGAGGCACTGACAGTGAAGAACCAGCGCCTAGCGAAGTTGGCTTGATTGCTGGAACCAG
JMSF033J04+ CAGAGGCACTGACAGTGAAGAACCAGCGCCTAGCGAAGTTGGCTTGATTGCTGGAACCAG
                      ____________________________________________________________
consensus CAGAGGCACTGACAGTGAAGAACCAGCGCCTAGCGAAGTTGGCTTGATTGCTGGAACCAG
 
. : . : . : . : . : . :
JMFS005B11+ AGAAGCAGGCGGGAGGGGAGAGGA
JMFS155D09+ AGAAGCAGGCGGGAGGGGAGAGGAGAGT
JMSF033J04+ AGAAGCAGGCGGGAGGGGAGAGGAGAGTGGGAGACGGGGAGTGAGAGACGAAGAGAGCCC
                      ____________________________________________________________
consensus AGAAGCAGGCGGGAGGGGAGAGGAGAGTGGGAGACGGGGAGTGAGAGACGAAGAGAGCCC