Previous Contig 006883:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012B08Sequence459006883 (5)gb:AY081475_15687356e-33Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701720008751 (4)gb:AP002525_18224288e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046
JMSF029B01Sequence663006883 (5)gb:AY081475_15687352e-69Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701715008751 (4)gb:AY081475_15687359e-39Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701
JMSF033I08Sequence682006883 (5)gb:AY081475_15687356e-72Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701742008751 (4)gb:AY081475_15687352e-41Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701
JMSF039I09Sequence659006883 (5)gb:AY081475_15687351e-86Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701904023854gb:AY081475_15687359e-35Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701
JMSF043I16Sequence761006883 (5)gb:AY081475_15687356e-90Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701676008751 (4)gb:AY081475_15687352e-35Arabidopsis thaliana putative protein (F12E4_190) mRNA, complete cds.>gb:AF38701

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039I09+ TCATAAAGGCTGCAATACTGAACTTTGC
JMSF043I16+ AAGTATACCCTTGGTCATAAAGGCTGCAATACTGAACTTTGC
                      ____________________________________________________________
consensus AAGTATACCCTTGGTCATAAAGGCTGCAATACTGAACTTTGC
 
. : . : . : . : . : . :
JMSF039I09+ AAGTCAAAAGGAAAGCCCATACATCTCTATATGACCAATCCAAAATTGGATTCACCCTCA
JMSF043I16+ AAGTCAAAAGGAAAGCCCATACATCTCTATATGACCAATCCAAAATTGGATTCACCCTCA
JMSF029B01+ TTCACCCTCA
JMSF033I08+ TCCAAAATTGGATTCACCCTCA
                      ____________________________________________________________
consensus AAGTCAAAAGGAAAGCCCATACATCTCTATATGACCAATCCAAAATTGGATTCACCCTCA
 
. : . : . : . : . : . :
JMSF039I09+ TGAAAGGTGGCCAGCCAGGTGAGCTAGGCGAGAATTGTTCTTGACCTACCGCAGTAGGAT
JMSF043I16+ TGAAAGGTGGCCAGCCAGGTGAGCTAGGCGAGAATTGTTCTTGACCTACCGCAGTAGGAT
JMSF029B01+ TGAAAGGTGGCCAGCCAGGTGAGCTAGGCGAGAATTGTTCTTGACCTACCGCAGTAGGAT
JMSF033I08+ TGAAAGGTGGCCAGCCAGGTGAGCTAGGCGAGAATTGTTCTTGACCTACCGCAGTAGGAT
                      ____________________________________________________________
consensus TGAAAGGTGGCCAGCCAGGTGAGCTAGGCGAGAATTGTTCTTGACCTACCGCAGTAGGAT
 
. : . : . : . : . : . :
JMSF039I09+ CACCAATTCGAACACCAAGAAAAATGGCTTTAATTGGATTAGCCTTTAGCAGAGACTCTA
JMSF043I16+ CACCAATTCGAACACCAAGAAAAATGGCTTTAATTGGATTAGCCTTTAGCAGAGACTCTA
JMSF029B01+ CACCAATTCGAACACCAAGAAAAATGGCTTTAATTGGATTAGCCTTTAGCAGAGACTCTA
JMSF033I08+ CACCAATTCGAACACCAAGAAAAATGGCTTTAATTGGATTAGCCTTTAGCAGAGACTCTA
                      ____________________________________________________________
consensus CACCAATTCGAACACCAAGAAAAATGGCTTTAATTGGATTAGCCTTTAGCAGAGACTCTA
 
. : . : . : . : . : . :
JMSF039I09+ AACCAGATTTAAAGTCAAGGCGAATAATATCCATTTGCAAATTGTACATTGCAGCAATTT
JMSF043I16+ AACCAGATTTAAAGTCAAGGCGAATAATATCCATTTGCAAATTGTACATTGCAGCAATTT
JMSF029B01+ AACCAGATTTAAAGTCAAGGCGAATAATATCCATTTGCAAATTGTACATTGCAGCAATTT
JMSF033I08+ AACCAGATTTAAAGTCAAGGCGAATAATATCCATTTGCAAATTGTACATTGCAGCAATTT
                      ____________________________________________________________
consensus AACCAGATTTAAAGTCAAGGCGAATAATATCCATTTGCAAATTGTACATTGCAGCAATTT
 
. : . : . : . : . : . :
JMSF039I09+ CATAGGTAAATGAATTTATCTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
JMSF043I16+ CATAGGTAAATGAATTTATCTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
JMSF029B01+ CATAGGTAAATGAATTTATCTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
JMFF012B08+ CTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
JMSF033I08+ CATAGGTAAATGAATTTATCTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
                      ____________________________________________________________
consensus CATAGGTAAATGAATTTATCTCCGGAAAAGCAGACGAGCTTTCAAAATATATTGTGCGTA
 
. : . : . : . : . : . :
JMSF039I09+ TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
JMSF043I16+ TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
JMSF029B01+ TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
JMFF012B08+ TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
JMSF033I08+ TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
                      ____________________________________________________________
consensus TTGGAAATGGTATTTCACCATAACCAAGGTCCCCATTGGAATGACACTTCTCACTTTCAT
 
. : . : . : . : . : . :
JMSF039I09+ GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
JMSF043I16+ GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
JMSF029B01+ GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
JMFF012B08+ GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
JMSF033I08+ GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
                      ____________________________________________________________
consensus GCAAGTAATAGCCTGCCCTAAGCAGGTGAAACAAAACAGTAGAATCTTTCCCTCCATTGA
 
. : . : . : . : . : . :
JMSF039I09+ AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
JMSF043I16+ AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
JMSF029B01+ AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
JMFF012B08+ AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
JMSF033I08+ AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
                      ____________________________________________________________
consensus AGCTCAGTGCAACCTCTTCTATAGAATATAGAGCAAGAGCTCTTTTGATCACATAAATGG
 
. : . : . : . : . : . :
JMSF039I09+ CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
JMSF043I16+ CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
JMSF029B01+ CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
JMFF012B08+ CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
JMSF033I08+ CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
                      ____________________________________________________________
consensus CATTGTTGTACTTTGTTTTAAGTCTTCGATCATCACATTCTCTGATTGCTTTATCAATCT
 
. : . : . : . : . : . :
JMSF039I09+ CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
JMSF043I16+ CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
JMSF029B01+ CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
JMFF012B08+ CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
JMSF033I08+ CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
                      ____________________________________________________________
consensus CCATGGCTTCCTGTCTACAAACTGAACCCTTCTGATGTTGAAGGGTTCAAGCACCGAGGG
 
. : . : . : . : . : . :
JMSF039I09+ AGGAGACTTTGACGGCTGAGAAATGTATTC
JMSF043I16+ AGGAGACTTTGACGGCTGAGAAATGTATTCAGAAACTCTACTTACACGGGGAAGGTTAGT
JMSF029B01+ AGGAGACTTTGACGGCTGAGAAATGTATTCAGAAACTCTACTTACACGGGGAAGGTTAGT
JMFF012B08+ AGGAGACTTTGACGGCTGAGAAATGTATTCAGAAACTCTACTTACACGGGGAAGGTTAGT
JMSF033I08+ AGGAGACTTTGACGGCTGAGAAATGTATTCAGAAACTCTACTTACACGGGGAAGGTTAGT
                      ____________________________________________________________
consensus AGGAGACTTTGACGGCTGAGAAATGTATTCAGAAACTCTACTTACACGGGGAAGGTTAGT
 
. : . : . : . : . : . :
JMSF043I16+ TATGTACCACAGACCGCCTATCTTCTTTCCTTCTGAGGAAAAACACAATCCC
JMSF029B01+ TATGTACCACAGACCGCCTATCTTCTTTCCTTCTGAGGAAAAACACAATCCC
JMFF012B08+ TATGTACCACAGACCGCCTATCTTCTTTCCTTCTGAGGAAAAACACAATCCC
JMSF033I08+ TATGTACCACAGACCGCCTATCTTCTTTCCTTCTGAGGAAAAACACAATCCCAAAAAATC
                      ____________________________________________________________
consensus TATGTACCACAGACCGCCTATCTTCTTTCCTTCTGAGGAAAAACACAATCCCAAAAAATC