Previous Contig 006877:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033G01Sequence720006877 (2)754013005 (2)gb:AP004636_18423894e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P068
JMSF035O18Sequence720006877 (2)683013005 (2)gb:AP004636_18423894e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P068

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033G01+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF035O18+ TGCGCTTTTCTCGACGACACTCACCGCCGTTACCATTTTTTACGGGTGCCA
JMSF033G01+ GGTGGTTTNTGCGCTTTTCTCGACGACACTCACCGCCGTTACCA-TTTTTACGGGTGCCA
                      ____________________________________________________________
consensus GGTGGTTTNTGCGCTTTTCTCGACGACACTCACCGCCGTTACCATTTTTTACGGGTGCCA
 
. : . : . : . : . : . :
JMSF035O18+ GTGCGAGTGAGGCGGCGGAGCAGCCGCCGGTAAATAATAACGTCTTGCCACTACGCCTCG
JMSF033G01+ GTGCGAGTGAGGCGGCGGAGCAGCCGCCGGTAAATAATAACGTCTTGCCACTACGCCTCG
                      ____________________________________________________________
consensus GTGCGAGTGAGGCGGCGGAGCAGCCGCCGGTAAATAATAACGTCTTGCCACTACGCCTCG
 
. : . : . : . : . : . :
JMSF035O18+ TCGGTGGTTTCCGCGCTTTCTCTNGACGACAGTCAACGCCGCCGCTACCTTTTCTGACGG
JMSF033G01+ TCGGTGGTTTCCGCGCTTTCTCTCGACGACAGTCAACGCCGCCGCTACCTTTTCTGACGG
                      ____________________________________________________________
consensus TCGGTGGTTTCCGCGCTTTCTCTCGACGACAGTCAACGCCGCCGCTACCTTTTCTGACGG
 
. : . : . : . : . : . :
JMSF035O18+ GTGCCAGTGCCAGTGAGGCGGCGGAGCAGCCGCCGGCAAATAGTAACGCCTTGCCACCAC
JMSF033G01+ GTGCCAGTGCCAGTGAGGCGGCGGAGCAGCCGCCGGCAAATAGTAACGCCTTGCCACCAC
                      ____________________________________________________________
consensus GTGCCAGTGCCAGTGAGGCGGCGGAGCAGCCGCCGGCAAATAGTAACGCCTTGCCACCAC
 
. : . : . : . : . : . :
JMSF035O18+ GCCTCGCCGGCGACGGCGGCGACGCCGCGTAGTCGCGGAATGTGGAGCGTGGTTTCTGGA
JMSF033G01+ GCCTCGCCGGCGACGGCGGCGACGCCGCGTAGTCGCGGAATGTGGAGCGTGGTTTCTGGA
                      ____________________________________________________________
consensus GCCTCGCCGGCGACGGCGGCGACGCCGCGTAGTCGCGGAATGTGGAGCGTGGTTTCTGGA
 
. : . : . : . : . : . :
JMSF035O18+ CTAACCGCATGTACTTCTCATTGCCTATAAAAGGCGAAATTCTCTTGTCCCCAGAACCCT
JMSF033G01+ CTAACCGCATGTACTTCTCATTGCCTATAAAAGGCGAAATTCTCTTGTCCCCAGAACCCT
                      ____________________________________________________________
consensus CTAACCGCATGTACTTCTCATTGCCTATAAAAGGCGAAATTCTCTTGTCCCCAGAACCCT
 
. : . : . : . : . : . :
JMSF035O18+ CGTATCTCGACTCAACAGAATAGTAAACTGGTAAATTACGATAATTCAACGGTCCATTAG
JMSF033G01+ CGTATCTCGACTCAACAGAATAGTAAACTGGTAAATTACGATAATTCAACGGTCCATTAG
                      ____________________________________________________________
consensus CGTATCTCGACTCAACAGAATAGTAAACTGGTAAATTACGATAATTCAACGGTCCATTAG
 
. : . : . : . : . : . :
JMSF035O18+ ACGGGAGGAGCATGTATTTTTCATTACTAGGGACGAAGAGCGTCGGGCGTTGATGATGCC
JMSF033G01+ ACGGGAGGAGCATGTATTTTTCATTACTAGGGACGAAGAGCGTCGGGCGTTGATGATGCC
                      ____________________________________________________________
consensus ACGGGAGGAGCATGTATTTTTCATTACTAGGGACGAAGAGCGTCGGGCGTTGATGATGCC
 
. : . : . : . : . : . :
JMSF035O18+ GGCGAGTCGGCGGCGTGGCAGCGGCGGCGCGGGAACCAGGGGGTGTCATGCTGCGGCGGC
JMSF033G01+ GGCGAGTCGGCGGCGTGGCAGCGGCGGCGCGGGAACCAGGGGGTGTCATGCTGCGGCGGC
                      ____________________________________________________________
consensus GGCGAGTCGGCGGCGTGGCAGCGGCGGCGCGGGAACCAGGGGGTGTCATGCTGCGGCGGC
 
. : . : . : . : . : . :
JMSF035O18+ GGAGAACCGCCGTGGCTTTGTCGGACCGGCATGAAAACCCTCTCATCATATTCATAGTCT
JMSF033G01+ GGAGAACCGCCGTGGCTTTGTCGGACCGGCATGAAAACCCTCTCATCATATTCATAGTCT
                      ____________________________________________________________
consensus GGAGAACCGCCGTGGCTTTGTCGGACCGGCATGAAAACCCTCTCATCATATTCATAGTCT
 
. : . : . : . : . : . :
JMSF035O18+ TCCCCGTCGTCGATCCTAACACGGCCTTCTTCATCTTGAATTTCATGCTACCTTAAATCT
JMSF033G01+ TCCCCGTCGTCGATCCTAACACGGCCTTCTTCATCTTGAATTTCATGCTACCTTAAATCT
                      ____________________________________________________________
consensus TCCCCGTCGTCGATCCTAACACGGCCTTCTTCATCTTGAATTTCATGCTACCTTAAATCT
 
. : . : . : . : . : . :
JMSF035O18+ TCCGAGGTCGGCCGGTGAATAGTAATTGGGGACGCCGGAGAATTTAAAACTAGGTG
JMSF033G01+ TCCGAGGTCGGCCGGTGAATAGTAATTGGGGACGCCGGAGAATTTAAAACTAGGTGCAGC
                      ____________________________________________________________
consensus TCCGAGGTCGGCCGGTGAATAGTAATTGGGGACGCCGGAGAATTTAAAACTAGGTGCAGC