Previous Contig 006870:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS103A04Sequence570006870 (3)gb:AB117525_15277401e-14Nicotiana tabacum NtMKP1 mRNA for MAP kinase phosphatase, complete cds.
JMFS158C10Sequence415006870 (3)gb:AB117525_15277404e-42Nicotiana tabacum NtMKP1 mRNA for MAP kinase phosphatase, complete cds.
JMSF033D01Sequence641006870 (3)gb:AB117525_15277401e-21Nicotiana tabacum NtMKP1 mRNA for MAP kinase phosphatase, complete cds.663023566gb:AB117525_15277403e-32Nicotiana tabacum NtMKP1 mRNA for MAP kinase phosphatase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS158C10+ TTAAAGAACGCAAGCTTGTCTCGCTTGAACTGAAATTCCCTCGGAGGCTGCTCGG
                      ____________________________________________________________
consensus TTAAAGAACGCAAGCTTGTCTCGCTTGAACTGAAATTCCCTCGGAGGCTGCTCGG
 
. : . : . : . : . : . :
JMFS158C10+ ACGTCGAAGTCTCCTGGATGGTAATCGGCCCGAGGCGGGCCCCGGGAGTAGGAGGGTTGT
                      ____________________________________________________________
consensus ACGTCGAAGTCTCCTGGATGGTAATCGGCCCGAGGCGGGCCCCGGGAGTAGGAGGGTTGT
 
. : . : . : . : . : . :
JMFS158C10+ TTGGCCACACACCTAGATCATCTGACCCAGCACTAGGCCACTCCTCAGCCTTTGGCCTGT
JMFS103A04+ CTGT
JMSF033D01+ ATCTGACCCAGCACTAGGCCACTCCTCAGCCTTTGGCCTGT
                      ____________________________________________________________
consensus TTGGCCACACACCTAGATCATCTGACCCAGCACTAGGCCACTCCTCAGCCTTTGGCCTGT
 
. : . : . : . : . : . :
JMFS158C10+ TGATTGAAAGTGGTTGAAGGGGAGGCAAACAAGCCCTTGCCTTACTATTCCATTGTCTCC
JMFS103A04+ TGATTGAAAGTGGTTGAAGGGGAGGCAAACAAGCCCTTGCCTTACTATTCCATTGTTTCT
JMSF033D01+ TGATTGAAAGTGGTTGAAGGGGAGGCAAACAAGCCCTTGCCTTACTATTCCATTGTTTCT
                      ____________________________________________________________
consensus TGATTGAAAGTGGTTGAAGGGGAGGCAAACAAGCCCTTGCCTTACTATTCCATTGTTTCT
 
. : . : . : . : . : . :
JMFS158C10+ TGGCAAAATTTGATTTCCTAGGAGAGCGGTCAGTCCAGGAAGCAGACCGAGCATATGTTC
JMFS103A04+ TGGCAAAATTTGATTTCCTAGGAGAGCGGTCAGTCCAGGAAGCAGACCGAGCATATGTTC
JMSF033D01+ TGGCAAAATTTGATTTCCTAGGAGAGCGGTCAGTCCAGGAAGCAGACCGAGCATATGTTC
                      ____________________________________________________________
consensus TGGCAAAATTTGATTTCCTAGGAGAGCGGTCAGTCCAGGAAGCAGACCGAGCATATGTTC
 
. : . : . : . : . : . :
JMFS158C10+ TCCGATTCCCGCCGCCGGATAACACATCTTTATCATTATCTTCACCCCCAAGCATATTCA
JMFS103A04+ TCCGATTCCCGCCGCCGGATAACACATCTTTATCATTATCTTCACCCCCAAGCATATTCA
JMSF033D01+ TCCGATTCCCGCCGCCGGATAACACATCTTTATCATTATCTTCACCCCCAAGCATATTCA
                      ____________________________________________________________
consensus TCCGATTCCCGCCGCCGGATAACACATCTTTATCATTATCTTCACCCCCAAGCATATTCA
 
. : . : . : . : . : . :
JMFS158C10+ ATTCCCAGAGAAAAANTAAACCTCCCCAGAACCAATCACACTCATGTGAGGATTGTTCCA
JMFS103A04+ ATTCCCAGAGAAAAACTAAACCTCCCCAGAACCAATCACACTCATGTGAGGATTGTTCCA
JMSF033D01+ ATTCCCAGAGAAAAACTAAACCTCCCCAGAACCAATCACACTCATGTGAGGATTGTTCCA
                      ____________________________________________________________
consensus ATTCCCAGAGAAAAACTAAACCTCCCCAGAACCAATCACACTCATGTGAGGATTGTTCCA
 
. : . : . : . : . : . :
JMFS103A04+ GGAAACCCCATAAAGTCCTCACAAATTCAAACAGACCCTTATAGAATTAGCTCCATGGAA
JMSF033D01+ GGAAACCCCATAAAGTCCTCACAAATTCAAACAGACCCTTATAGAATTAGCTCCATGGAA
                      ____________________________________________________________
consensus GGAAACCCCATAAAGTCCTCACAAATTCAAACAGACCCTTATAGAATTAGCTCCATGGAA
 
. : . : . : . : . : . :
JMFS103A04+ AACCTAAACAGTGGATAAAAGTTGAGTCTTGATTGACAGAATTTCAGAAATTCAAAGAAA
JMSF033D01+ AACCTAAACAGTGGATAAAAGTTGAGTCTTGATTGACAGAATTTCAGAAATTCAAAGAAA
                      ____________________________________________________________
consensus AACCTAAACAGTGGATAAAAGTTGAGTCTTGATTGACAGAATTTCAGAAATTCAAAGAAA
 
. : . : . : . : . : . :
JMFS103A04+ CCCCATGGAAGGATGAAGCCCACATGTTCAATTTTTCATTCATTCATTCATTCAAACAAA
JMSF033D01+ CCCCATGGAAGGATGAAGCCCACATGTTCAATTTTTCATTCATTCATTCATTCAAACAAA
                      ____________________________________________________________
consensus CCCCATGGAAGGATGAAGCCCACATGTTCAATTTTTCATTCATTCATTCATTCAAACAAA
 
. : . : . : . : . : . :
JMFS103A04+ CAGCTGGGCTGCCCGTTCAAAGATTCTTTTTTGATTCCATTTTCCAACCACCTAAAAGCC
JMSF033D01+ CAGCTGGGCTGCCCGTTCAAAGATTCTTTTTTGATTCCATTTTCCAACCACCTAAAAGCC
                      ____________________________________________________________
consensus CAGCTGGGCTGCCCGTTCAAAGATTCTTTTTTGATTCCATTTTCCAACCACCTAAAAGCC
 
. : . : . : . : . : . :
JMFS103A04+ TTGACCACCTCCCCGTTTTGGGAAAGGGTGGATTGGTTGTTGGGTATTTGCAGCAGCCAC
JMSF033D01+ TTGACCACCTCCCCGTTTTGGGAAAGGGTGGATTGGTTGTTGGGTATTTGCAGCAGCCAC
                      ____________________________________________________________
consensus TTGACCACCTCCCCGTTTTGGGAAAGGGTGGATTGGTTGTTGGGTATTTGCAGCAGCCAC
 
. : . : . : . : . : . :
JMFS103A04+ TTTGGTTTTTGAAAAAACTCTCAAAA
JMSF033D01+ TTTGGTTTTTGAAAAAACTCTCAAAATTTGAAGTCTTTGAATGATTGATGATGATGAACC
                      ____________________________________________________________
consensus TTTGGTTTTTGAAAAAACTCTCAAAATTTGAAGTCTTTGAATGATTGATGATGATGAACC