Previous Contig 006867:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033C15Sequence673006867 (2)gb:AY080677_15684072e-39Arabidopsis thaliana unknown protein (At2g42975) mRNA, complete cds.>gb:AY133735640006867 (2)gb:AY080677_15684072e-39Arabidopsis thaliana unknown protein (At2g42975) mRNA, complete cds.>gb:AY133735

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033C15+ GCTAGCAAATAGA
JMSF033C15- GCTAGCAAATAGA
                      ____________________________________________________________
consensus GCTAGCAAATAGA
 
. : . : . : . : . : . :
rJMSF033C15+ AGAAGAAGAACCGGAACAATATTACTCGTACCATGGCATTAAATTTCAGCACAGTTCCGC
JMSF033C15- AGAAGAAGAACCGGAACAATATTACTCGTACCATGGCATTAAATTTCAGCACAGTTCCGC
                      ____________________________________________________________
consensus AGAAGAAGAACCGGAACAATATTACTCGTACCATGGCATTAAATTTCAGCACAGTTCCGC
 
. : . : . : . : . : . :
rJMSF033C15+ TTCACACAAAACACCCTTCTTTCTTGATTCCAAATCACAAGCGTGACCTCAACAGGCTGT
JMSF033C15- TTCACACAAAACACCCTTCTTTCTTGATTCCAAATCACAAGCGTGACCTCAACAGGCTGT
                      ____________________________________________________________
consensus TTCACACAAAACACCCTTCTTTCTTGATTCCAAATCACAAGCGTGACCTCAACAGGCTGT
 
. : . : . : . : . : . :
rJMSF033C15+ GTTCTTCTCAGCCTTGGCTCTCATCGTCTGCCAGAGCGGCGGCTTTGTCTGAAGGGACAG
JMSF033C15- GTTCTTCTCAGCCTTGGCTCTCATCGTCTGCCAGAGCGGCGGCTTTGTCTGAAGGGACAG
                      ____________________________________________________________
consensus GTTCTTCTCAGCCTTGGCTCTCATCGTCTGCCAGAGCGGCGGCTTTGTCTGAAGGGACAG
 
. : . : . : . : . : . :
rJMSF033C15+ AAGGTGGAGTTACAGAGAAGGAACCCCCAGATTACTCTGGGTCAGCAACTTCAGCTCGTG
JMSF033C15- AAGGTGGAGTTACAGAGAAGGAACCCCCAGATTACTCTGGGTCAGCAACTTCAGCTCGTG
                      ____________________________________________________________
consensus AAGGTGGAGTTACAGAGAAGGAACCCCCAGATTACTCTGGGTCAGCAACTTCAGCTCGTG
 
. : . : . : . : . : . :
rJMSF033C15+ CACAACTTGATCTCTTGGAACAGCTCACTTCAAGTAGCCTGGATTTTAATGGCTATGAAA
JMSF033C15- CACAACTTGATCTCTTGGAACAGCTCACTTCAAGTAGCCTGGATTTTAATGGCTATGAAA
                      ____________________________________________________________
consensus CACAACTTGATCTCTTGGAACAGCTCACTTCAAGTAGCCTGGATTTTAATGGCTATGAAA
 
. : . : . : . : . : . :
rJMSF033C15+ GTGATGGTGGTTCAAGCGGATTGAGTATTCGTGATCAGCTCGCCAAGTTGGTTGGCGAGC
JMSF033C15- GTGATGGTGGTTCAAGCGGATTGAGTATTCGTGATCAGCTCGCCAAGTTGGTTGGCGAGC
                      ____________________________________________________________
consensus GTGATGGTGGTTCAAGCGGATTGAGTATTCGTGATCAGCTCGCCAAGTTGGTTGGCGAGC
 
. : . : . : . : . : . :
rJMSF033C15+ GAGATGATGATTTCAACATCCCGTTGGGTAAGAATTTGAAGAAGTTTACTCCAAAGTTTT
JMSF033C15- GAGATGATGATTTCAACATCCCGTTGGGTAAGAATTTGAAGAAGTTTACTCCAAAGTTTT
                      ____________________________________________________________
consensus GAGATGATGATTTCAACATCCCGTTGGGTAAGAATTTGAAGAAGTTTACTCCAAAGTTTT
 
. : . : . : . : . : . :
rJMSF033C15+ TAACCATTTCACAGAAGAGAAACATCAAAAGACAGGCTTACCTAAATGAGGTATCTCAAA
JMSF033C15- TAACCATTTCACAGAAGAGAAACATCAAAAGACAGGCTTACCTAAATGAGGTATCTCAAA
                      ____________________________________________________________
consensus TAACCATTTCACAGAAGAGAAACATCAAAAGACAGGCTTACCTAAATGAGGTATCTCAAA
 
. : . : . : . : . : . :
rJMSF033C15+ GAAACGACTCGGTTTTCTTCGCAACCATTGGAGCGTTTGTAATCCTTCCACCCATTATTA
JMSF033C15- GAAACGACTCGGTTTTCTTCGCAACCATTGGAGCGTTTGTAATCCTTCCACCCATTATTA
                      ____________________________________________________________
consensus GAAACGACTCGGTTTTCTTCGCAACCATTGGAGCGTTTGTAATCCTTCCACCCATTATTA
 
. : . : . : . : . : . :
rJMSF033C15+ TCTTAGGAATCGCGATAGCAACTGGTTATGTGCAGCTATTTCCATGACTTGCCTATTGCT
JMSF033C15- TCTTAGGAATCGCGATAGCAACTGGTTATGTGCAGCTATTTCCATGACTTGCCTATTGCT
                      ____________________________________________________________
consensus TCTTAGGAATCGCGATAGCAACTGGTTATGTGCAGCTATTTCCATGACTTGCCTATTGCT
 
. : . : . : . : . : . :
rJMSF033C15+ TTCTCTGTAACTTATACTTTTCGT
JMSF033C15- TTCTCTGTAACTTATACTTTTCGTTATCAATCTGATGCAATAATATATGTGTTTATTAGT
                      ____________________________________________________________
consensus TTCTCTGTAACTTATACTTTTCGTTATCAATCTGATGCAATAATATATGTGTTTATTAGT