Previous Contig 006863:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047F05Sequence644006863 (6)pir|D84720|D847202e-45hypothetical protein At2g31410 [imported] - Arabidopsis thaliana>gb:AC007169_153592006863 (6)pir|D84720|D847203e-16hypothetical protein At2g31410 [imported] - Arabidopsis thaliana>gb:AC007169_153
JMFF049A21Sequence429006863 (6)pir|D84720|D847209e-26hypothetical protein At2g31410 [imported] - Arabidopsis thaliana>gb:AC007169_153484006863 (6)pir|D84720|D847204e-04hypothetical protein At2g31410 [imported] - Arabidopsis thaliana>gb:AC007169_153
JMFS015D10Sequence540006863 (6)
JMSF033B01Sequence668006863 (6)pir|D84720|D847209e-06hypothetical protein At2g31410 [imported] - Arabidopsis thaliana>gb:AC007169_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047F05- CGACAACGAAGTAATAAATTGTGAATATAGCACACAAC
                      ____________________________________________________________
consensus CGACAACGAAGTAATAAATTGTGAATATAGCACACAAC
 
. : . : . : . : . : . :
rJMFF049A21- TGCCCAAGAGCTTCAGTTTGAAGCATTTAAAATTGTAGACTAATAATCCTCTTCTCAAC
rJMFF047F05- ATGCCCAAGAGCTTCAGTTTGAAGCATTTAAAATTGTAGACTAATAATCCTCTTCTCAAC
                      ____________________________________________________________
consensus ATGCCCAAGAGCTTCAGTTTGAAGCATTTAAAATTGTAGACTAATAATCCTCTTCTCAAC
 
. : . : . : . : . : . :
rJMFF049A21- ACTAGTCCTGTTGGCCCTATACTATATAATGAGAGAACAAGAATTGAAACACAGTTTACA
rJMFF047F05- ACTAGTCCTGTTGGCCCTATACTATATAATGAGAGAACAAGAATTGAAACACAGTTTACA
                      ____________________________________________________________
consensus ACTAGTCCTGTTGGCCCTATACTATATAATGAGAGAACAAGAATTGAAACACAGTTTACA
 
. : . : . : . : . : . :
rJMFF049A21- TGATTGAAATTGAAATTGAAATTGAAATAAAATCATACCATTTCCAGAGACCTATAATGA
rJMFF047F05- TGATTGAAATTGAAATTGAAATTGAAATAAAATCATACCATTTCCAGAGACCTATAATGA
                      ____________________________________________________________
consensus TGATTGAAATTGAAATTGAAATTGAAATAAAATCATACCATTTCCAGAGACCTATAATGA
 
. : . : . : . : . : . :
rJMFF049A21- AAAGGAAGGTATAAGAAGCACAAGTAAAGGGGCAAAGAGATGCTACTACTTAAGAAGATC
rJMFF047F05- AAAGGAAGGTATAAGAAGCACAAGTAAAGGGGCAAAGAGATGCTACTACTTAAGAAGATC
                      ____________________________________________________________
consensus AAAGGAAGGTATAAGAAGCACAAGTAAAGGGGCAAAGAGATGCTACTACTTAAGAAGATC
 
. : . : . : . : . : . :
rJMFF049A21- ATCGGAAACAACCTTGAGGAGCTTCTTATGCTTGGCAGATTTGGCAATTTTCTTAAGAGT
rJMFF047F05- ATCGGAAACAACCTTGAGGAGCTTCTTATGCTTGGCAGATTTGGCAATTTTCTTAAGAGT
JMFF047F05+ TGCTTGGCAGATTTGGCAATTTTCTTAAGAGT
                      ____________________________________________________________
consensus ATCGGAAACAACCTTGAGGAGCTTCTTATGCTTGGCAGATTTGGCAATTTTCTTAAGAGT
 
. : . : . : . : . : . :
rJMFF049A21- CTTAGGGTTGGTGATCTTTTGAAACTTGGTACCAGACTTGAGAATGTTGTCCTTCTTCCT
rJMFF047F05- CTTAGGGTTGGTGATCTTTTGAAACTTGGTACCAGACTTGAGAATGTTGTCCTTCTTCCT
JMFF047F05+ CTTAGGGNTGGTGATCTTTTGAAACTTGGTACCAGACTGNAGAATGTTGTCCTTCTTCCT
                      ____________________________________________________________
consensus CTTAGGGTTGGTGATCTTTTGAAACTTGGTACCAGACTTGAGAATGTTGTCCTTCTTCCT
 
. : . : . : . : . : . :
rJMFF049A21- CTTCTCCCTCTCCTCCCTCTTCTGCCGCTTCTCTATCTTGTTCTGCCTTATCTCCTCCTT
rJMFF047F05- CTTCTCCCTCTCCTCCCTCTTCTGCCGCTTCTCTATCTTGTTCTGCCTTATCTCCTCCTT
JMFF047F05+ CTTCTCCCTCTCCTCCCTCTTCTGCCGCTTCTCTATCTTGTTCTGCCTTATCTCCTCCTT
                      ____________________________________________________________
consensus CTTCTCCCTCTCCTCCCTCTTCTGCCGCTTCTCTATCTTGTTCTGCCTTATCTCCTCCTT
 
. : . : . : . : . : . :
rJMFF049A21- CAGNTCATTCATTCTCTC-TTGGACGCCTTCTTTATCTC
rJMFF047F05- CAGTTCATTCATTCTCTCTTTGTACGCCTTCTTTATCTCTTTCTCCTTCACCCTCTGCTC
JMFF047F05+ CAGTTCATTCATTCTCTCTTTGTACGCCTTCTTTATCTCTTTCTCCTTCACCCTCTGCTC
                      ____________________________________________________________
consensus CAGTTCATTCATTCTCTCTTTGTACGCCTTCTTTATCTCTTTCTCCTTCACCCTCTGCTC
 
. : . : . : . : . : . :
rJMFF047F05- CAGCGTCTTCCCCTTCCGGCTCACCTGCACCGCCGACGACCTGTGCGTCCGTGCCTGCTT
JMFF047F05+ CAGCGTCTTCCCCTTCCGGCTCACCTGCACCGCCGACGACCTGTGCGTCCGTGCCTGCTT
                      ____________________________________________________________
consensus CAGCGTCTTCCCCTTCCGGCTCACCTGCACCGCCGACGACCTGTGCGTCCGTGCCTGCTT
 
. : . : . : . : . : . :
rJMFF047F05- CCACTTCCT
JMFF047F05+ CCACTTCCTACCTGACACCTTCCCCGCTATAACACCGTCGTACGTCGGCCTGTTCGGATC
JMFF049A21+ TGTTCGGATC
                      ____________________________________________________________
consensus CCACTTCCTACCTGACACCTTCCCCGCTATAACACCGTCGTACGTCGGCCTGTTCGGATC
 
. : . : . : . : . : . :
JMFF047F05+ CTCAGAAGAAGGGACCGCCTGCCTTTTCGACGGAGGGGGGCCGCTTTCCTCTTCCACCTC
JMFF049A21+ CTCAGAAGAAGGGACCGCCTGCCTTTTCGACGGAGGGGGGCCGCTTTCCTCTTCCACCTC
                      ____________________________________________________________
consensus CTCAGAAGAAGGGACCGCCTGCCTTTTCGACGGAGGGGGGCCGCTTTCCTCTTCCACCTC
 
. : . : . : . : . : . :
JMFF047F05+ CATGGTGCCCGCGTCTTCCTCCGATACATCGCCGGGGGCTTCCTTCTCTGCCCTCTTTCG
JMFF049A21+ CATGGTGCCCGCGTCTTCCTCCGATACATCGCCGGGGGCTTCCTTCTCTGCCCTCTTTCG
JMSF033B01+ CTCTTTCG
                      ____________________________________________________________
consensus CATGGTGCCCGCGTCTTCCTCCGATACATCGCCGGGGGCTTCCTTCTCTGCCCTCTTTCG
 
. : . : . : . : . : . :
JMFF047F05+ CTTGTAAGTTTTGCCTCCGAAGCCCTCATCCAGGCACCCAAAATCAATGGTACACGCCAT
JMFF049A21+ CTTGTAAGTTTTGCCTCCGAAGCCCTCATCCAGGCACCTAAAATCAATGGTACACGCCAT
JMSF033B01+ CTTGTAAGTTTTGCCTCCGAAACCCTCATCCAGGCACCTAAAATCAATGGTACATGCCAT
                      ____________________________________________________________
consensus CTTGTAAGTTTTGCCTCCGAAGCCCTCATCCAGGCACCTAAAATCAATGGTACACGCCAT
 
. : . : . : . : . : . :
JMFF047F05+ ATTCTCTTC
JMFF049A21+ ATTCTCTTC
JMFS015D10+ GAACAAGGAGATCAACCCTAG
JMSF033B01+ ATTCTCTTCGCTCACAGCAGCACCTCTAAATCTCTAATCGAACAAGGAGATCAACCCTAG
                      ____________________________________________________________
consensus ATTCTCTTCGCTCACAGCAGCACCTCTAAATCTCTAATCGAACAAGGAGATCAACCCTAG
 
. : . : . : . : . : . :
JMFS015D10+ TACTAGACTACTAGTTATATTCGGAAAAAATTTAAAAGATTAATAATCGAAAAAAAGAAT
JMSF033B01+ TACTAGACTACTAGTTATATTCGGAAAAAATTTAAAAGATTAATAATCGAAAAAAAGAAT
                      ____________________________________________________________
consensus TACTAGACTACTAGTTATATTCGGAAAAAATTTAAAAGATTAATAATCGAAAAAAAGAAT
 
. : . : . : . : . : . :
JMFS015D10+ AGAACATACATACAGATTTATATTGAAAGTAAAACTATTTACTGTTTTGAAGTTTAAACT
JMSF033B01+ AGAACATACATACAGATTTATATTGAAAGTAAAACTATTTACTGTTTTGAAGTTTAAACT
                      ____________________________________________________________
consensus AGAACATACATACAGATTTATATTGAAAGTAAAACTATTTACTGTTTTGAAGTTTAAACT
 
. : . : . : . : . : . :
JMFS015D10+ AACAGTCCATATACCAAGATAACCATGATTTATATCTGAAATTTTTAAATGAAACTATGA
JMSF033B01+ AACAGTCCATATACCAAGATAACCATGATTTATATCTGAAATTTTTAAATGAAACTATGA
                      ____________________________________________________________
consensus AACAGTCCATATACCAAGATAACCATGATTTATATCTGAAATTTTTAAATGAAACTATGA
 
. : . : . : . : . : . :
JMFS015D10+ AAGTATGAAATAACAAAAAACATAGTCTACTTTAATCTATTCCAATTTCAAGATATCATA
JMSF033B01+ AAGTATGAAATAACAAAAAACATAGTCTACTTTAATCTATTCCAATTTCAAGATATCATA
                      ____________________________________________________________
consensus AAGTATGAAATAACAAAAAACATAGTCTACTTTAATCTATTCCAATTTCAAGATATCATA
 
. : . : . : . : . : . :
JMFS015D10+ TTTCAAATTAAAAGTAACTTTTCCAGAATTTATCTATAAAAAATTTAAATGAAAATATGA
JMSF033B01+ TTTCAAATTAAAAGTAACTTTTCCAGAATTTATCTATAAAAAATTTAAATGAAAATATGA
                      ____________________________________________________________
consensus TTTCAAATTAAAAGTAACTTTTCCAGAATTTATCTATAAAAAATTTAAATGAAAATATGA
 
. : . : . : . : . : . :
JMFS015D10+ AACCTGGAGGGCTGGAGGGTAGAGCGTGCGACGGCGACGGCAGGGTGGAGCAGAGGAGAC
JMSF033B01+ AACCTGGAGGGCTGGAGGGTAGAGCGTGCGACGGCGACGGCAGGGTGGAGCAGAGGAGAC
                      ____________________________________________________________
consensus AACCTGGAGGGCTGGAGGGTAGAGCGTGCGACGGCGACGGCAGGGTGGAGCAGAGGAGAC
 
. : . : . : . : . : . :
JMFS015D10+ GGAGGCAACGACCTGGAGCAGAGGAGAACAGTCGCGACTCGCGTGTAGGCTTGGTGCCGG
JMSF033B01+ GGAGGCAACGACCTGGAGCAGAGGAGAACAGTCGCGACTCGCGTGTAGGCTTGGTGCCGG
                      ____________________________________________________________
consensus GGAGGCAACGACCTGGAGCAGAGGAGAACAGTCGCGACTCGCGTGTAGGCTTGGTGCCGG
 
. : . : . : . : . : . :
JMFS015D10+ TGGGCGGTGGTGGGTGAGAGACCTACAGTAGTTCTTCGGCTTCTTCTCAGACTGCAGAGA
JMSF033B01+ TGGGCGGTGGTGGGTGAGAGACCTACAGTAGTTCTTCGGCTTCTTCTCAGACTGCAGAGA
                      ____________________________________________________________
consensus TGGGCGGTGGTGGGTGAGAGACCTACAGTAGTTCTTCGGCTTCTTCTCAGACTGCAGAGA
 
. : . : . : . : . : . :
JMFS015D10+ GAAAGAGACGGCCAGTACTTCTGCAGTAATCAATTTTAG
JMSF033B01+ GAAAGAGACGGCCAGTACTTCTGCAGTAATCAATTTTAGGGTTGCTGGGTTGGGGTCTTC
                      ____________________________________________________________
consensus GAAAGAGACGGCCAGTACTTCTGCAGTAATCAATTTTAGGGTTGCTGGGTTGGGGTCTTC