Previous Contig 006858:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS056D10Sequence627006858 (5)gb:AY088165_15731871e-52Arabidopsis thaliana clone 42300 mRNA, complete sequence.
JMSF032P16Sequence654006858 (5)gb:AY088165_15731875e-43Arabidopsis thaliana clone 42300 mRNA, complete sequence.772006858 (5)gb:AY088165_15731875e-79Arabidopsis thaliana clone 42300 mRNA, complete sequence.
JMSF042N14Sequence788006858 (5)gb:AY088165_15731876e-75Arabidopsis thaliana clone 42300 mRNA, complete sequence.841006858 (5)gb:AY088165_15731875e-86Arabidopsis thaliana clone 42300 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042N14- ATTTGTTTGTGTAGAAAGGAAGAAACCTCCTTTAGTTAATA
                      ____________________________________________________________
consensus ATTTGTTTGTGTAGAAAGGAAGAAACCTCCTTTAGTTAATA
 
. : . : . : . : . : . :
rJMSF032P16- ATTACAAGATTATGTTACTCATAAAATTGGCATAGACCAGCTTCATCATTAT
rJMSF042N14- AGGAATCAATTACAAGATTATGTTACTCATAAAATTGGCATAGACCAGCTTCATCATTAT
                      ____________________________________________________________
consensus AGGAATCAATTACAAGATTATGTTACTCATAAAATTGGCATAGACCAGCTTCATCATTAT
 
. : . : . : . : . : . :
rJMSF032P16- TGTGAATGGTACAAAGGGAATTTCTCATTAGATTTTAGAACTACATACTATTGGAACCAG
rJMSF042N14- TGTGAATGGTACAAAGGGAATTTCTCATTAGATTTTAGAACTACATACTATTGGAACCAG
                      ____________________________________________________________
consensus TGTGAATGGTACAAAGGGAATTTCTCATTAGATTTTAGAACTACATACTATTGGAACCAG
 
. : . : . : . : . : . :
rJMSF032P16- ATCCACCACTGAGAATATCATCAAGTGAAATATAGCTTATCCCCTTTCTGATAAGTGATG
rJMSF042N14- ATCCACCACTGAGAATATCATCAAGTGAAATATAGCTTATCCCCTTTCTGATAAGTGATG
                      ____________________________________________________________
consensus ATCCACCACTGAGAATATCATCAAGTGAAATATAGCTTATCCCCTTTCTGATAAGTGATG
 
. : . : . : . : . : . :
rJMSF032P16- GAGCCGCTGCTTCTATAGTATCTTCTGCCAATGTTGTGGTCACTGCTATGCATCGCATTT
rJMSF042N14- GAGCCGCTGCTTCTATAGTATCTTCTGCCAATGTTGTGGTCACTGCTATGCATCGCATTT
                      ____________________________________________________________
consensus GAGCCGCTGCTTCTATAGTATCTTCTGCCAATGTTGTGGTCACTGCTATGCATCGCATTT
 
. : . : . : . : . : . :
rJMSF032P16- TTGCTGCTTTGGCAGCTTGTATACCAGCTAATGCATCTTCAATCACAACACACTCACTAG
rJMSF042N14- TTGCTGCTTTGGCAGCTTGTATACCAGCTAATGCATCTTCAATCACAACACACTCACTAG
JMSF042N14+ TAG
                      ____________________________________________________________
consensus TTGCTGCTTTGGCAGCTTGTATACCAGCTAATGCATCTTCAATCACAACACACTCACTAG
 
. : . : . : . : . : . :
rJMSF032P16- GGGGCACATTCAAAATCTTTGATGCTGCCAAAAATATATCAGGAGCAGGCTTCAAGTTTT
rJMSF042N14- GGGGCACATTCAAAATCTTTGATGCTGCCAAAAATATATCAGGAGCAGGCTTCAAGTTTT
JMSF042N14+ GGGGCACATTCAAAATCTTTGATGCTGCCAAAAATATATCAGGAGCAGGCTTCAAGTTTT
                      ____________________________________________________________
consensus GGGGCACATTCAAAATCTTTGATGCTGCCAAAAATATATCAGGAGCAGGCTTCAAGTTTT
 
. : . : . : . : . : . :
rJMSF032P16- CAAATGCATCAGCAGAAACAATTGCATCAAACATTGACAACGACAAACCAGCAGCTGTTA
rJMSF042N14- CAAATGCATCAGCAGAAACAATTGCATCAAACATTGACAACGACAAACCAGCAGCTGTTA
JMSF042N14+ CAAATGCATCAGCAGAAACAATTGCATCAAACATTGACAACGACAAACCAGCAGCTGTTA
                      ____________________________________________________________
consensus CAAATGCATCAGCAGAAACAATTGCATCAAACATTGACAACGACAAACCAGCAGCTGTTA
 
. : . : . : . : . : . :
rJMSF032P16- AGTTCGCATCGACCTTGATGCGATCAGCACTTGATGCAACAGCAACTTTGAGACCTTTGC
rJMSF042N14- AGTTCGCATCGACCTTGATGCGATCAGCACTTGATGCAACAGCAACTTTGAGACCTTTGC
JMFS056D10+ ACCTTGATGCGATCAGCACTTGATGCAACAGCAACTTTGAGACCTTTGC
JMSF042N14+ AGTTCGCATCGACCTTGATGCGATCAGCACTTGATGCAACAGCAACTTTGAGACCTTTGC
                      ____________________________________________________________
consensus AGTTCGCATCGACCTTGATGCGATCAGCACTTGATGCAACAGCAACTTTGAGACCTTTGC
 
. : . : . : . : . : . :
rJMSF032P16- TTTTACACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
rJMSF042N14- TTTTACACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
JMFS056D10+ TTTTACACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
JMSF042N14+ TTTTACACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
JMSF032P16+ ACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
                      ____________________________________________________________
consensus TTTTACACTGAGTGACAAGTTCAAAGGCACCAGGGAAACCTATGCCAGAATTTGGCTTTG
 
. : . : . : . : . : . :
rJMSF032P16- CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
rJMSF042N14- CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
JMFS056D10+ CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
JMSF042N14+ CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
JMSF032P16+ CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
                      ____________________________________________________________
consensus CATACTTATCTAAATATATCTCAAAAAACCTCTTCTTTGCTGCCTCGGGATTGAATCCAA
 
. : . : . : . : . : . :
rJMSF032P16- GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
rJMSF042N14- GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
JMFS056D10+ GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
JMSF042N14+ GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
JMSF032P16+ GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
                      ____________________________________________________________
consensus GAACACCCTTCACATTAGCAACACCACCTAAGAAGTTCGCTTCACCCATGCCCGTAAAGG
 
. : . : . : . : . : . :
rJMSF032P16- GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
rJMSF042N14- GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
JMFS056D10+ GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
JMSF042N14+ GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
JMSF032P16+ GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
                      ____________________________________________________________
consensus GCGCAAAGTCTTCTACTGTTACTTGAACCCCCATTTCCGCAAAAACATCTACAGCAGCCC
 
. : . : . : . : . : . :
rJMSF032P16- TTCTAGAAGGCTCCTCGCTGTTGC-AAGCACACCATCCATATCAAACAGCACGGCG
rJMSF042N14- TTCTAGAAGGCTCCTCGCTGTTGCAAAGCACACCATCCATATCAAACAGCACGGCGGAAA
JMFS056D10+ TTCTAGAAGGCTCCTCGCTGTTGCAAAGCACACCATCCATATCAAACAGCACGGCGGAGA
JMSF042N14+ TTCTAGAAGGCTCCTCGCTGTTGCAAAGCACACCATCCATATCAAACAGCACGGCGGAGA
JMSF032P16+ TTCTAGAAGGCTCCTCGCTGTTGCAAAGCACACCATCCATATCAAACAGCACGGCGGAGA
                      ____________________________________________________________
consensus TTCTAGAAGGCTCCTCGCTGTTGCAAAGCACACCATCCATATCAAACAGCACGGCGGAGA
 
. : . : . : . : . : . :
rJMSF042N14- CCTT
JMFS056D10+ CCTTTCCCCATTGATTCCCCGCCTCGGAGACATTAGTCTCCTCCAACTTCACGCACGCAT
JMSF042N14+ CCTTTCCCCATTGATTCCCCGCCTCGGAGACATTAGTCTCCTCCAACTTCACGCACGCAT
JMSF032P16+ CCTTTCCCCATTGATTCCCCGCCTCGGAGACATTAGTCTCCTCCAACTTCACGCACGCAT
                      ____________________________________________________________
consensus CCTTTCCCCATTGATTCCCCGCCTCGGAGACATTAGTCTCCTCCAACTTCACGCACGCAT
 
. : . : . : . : . : . :
JMFS056D10+ TCACCGCCAAACCCGACTTTCTCCGCCCCGAATTCGCGAAATGTTTCGGATAAAATCGGA
JMSF042N14+ TCACCGCCAAACCCGACTTTCTCCGCCCCGAATTCGCGAAATGTTTCGGATAAAATCGGA
JMSF032P16+ TCACCGCCAAACCCGACTTTCTCCGCCCCGAATTCGCGAAATGTTTCGGATAAAATCGGA
                      ____________________________________________________________
consensus TCACCGCCAAACCCGACTTTCTCCGCCCCGAATTCGCGAAATGTTTCGGATAAAATCGGA
 
. : . : . : . : . : . :
JMFS056D10+ CAAACGACGCCTGTTTGGAGCGAGAGAACTGCGCAAGCTTCGATTGAGAAGAAGAAGAAG
JMSF042N14+ CAAACGACGCCTGTTTGGAGCGAGAGAACTGCGCAAGCTTCGATTGAGAAGAAGAAGAAG
JMSF032P16+ CAAACGACGCCTGTTTGGAGCGAGAGAACTGCGCAAGCTTCGATTGAGAAGAAGAAGAAG
                      ____________________________________________________________
consensus CAAACGACGCCTGTTTGGAGCGAGAGAACTGCGCAAGCTTCGATTGAGAAGAAGAAGAAG
 
. : . : . : . : . : . :
JMFS056D10+ AAGAAAGAGTGGACAATGGCGGAGACAATAATAATAGTCTCAGTGCCATTTTTGTGAGGC
JMSF042N14+ AAGAAAGAGTGGACAATGGCGGAGACAATAATAATAGTCTCAGTGCCATTTTTGTGAGGC
JMSF032P16+ AAGAAAGAGTGGACAATGGCGGAGACAATAATAATAGTCTCAGTGCCATTTTTGTGAGGC
                      ____________________________________________________________
consensus AAGAAAGAGTGGACAATGGCGGAGACAATAATAATAGTCTCAGTGCCATTTTTGTGAGGC
 
. : . : . : . : . : . :
JMFS056D10+ CTCAAGCTCCACAGACCACAGTATACTTCTCTGTTTGG
JMSF042N14+ CTCAAGCTCCACAGACCACAGTATACTTCTCTGTTTGGCTTTGGCTGAAATGTAAATAAT
JMSF032P16+ CTCAAGCTCCACAGACCACAGTATACTTCTCTGTTTGGCTTTGGCTGAAATGTAAATAAT
                      ____________________________________________________________
consensus CTCAAGCTCCACAGACCACAGTATACTTCTCTGTTTGGCTTTGGCTGAAATGTAAATAAT
 
. : . : . : . : . : . :
JMSF042N14+ CCT
JMSF032P16+ CCTGATTCTGTATCGAGTGGCGGGGAAGGGGATTTCAGTTGTATTCCGTGTGATGGGACC
                      ____________________________________________________________
consensus CCTGATTCTGTATCGAGTGGCGGGGAAGGGGATTTCAGTTGTATTCCGTGTGATGGGACC