Previous Contig 006851:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B20Sequence592006851 (14)sp|Q38741|SBP1_ANTMA1e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding542006851 (14)sp|Q38741|SBP1_ANTMA5e-35Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFF007C15Sequence532006851 (14)sp|Q38741|SBP1_ANTMA1e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding714006851 (14)sp|Q38741|SBP1_ANTMA2e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFF024G11Sequence525006851 (14)sp|Q38741|SBP1_ANTMA1e-28Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding495006851 (14)sp|Q38741|SBP1_ANTMA1e-28Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFF038J19Sequence580006851 (14)sp|Q38741|SBP1_ANTMA1e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding727006851 (14)sp|Q38741|SBP1_ANTMA2e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFF038K23Sequence591006851 (14)sp|Q38741|SBP1_ANTMA1e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding713006851 (14)sp|Q38741|SBP1_ANTMA2e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFN013E11Sequence611006851 (14)sp|Q38741|SBP1_ANTMA1e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMFN038B11Sequence528006851 (14)sp|Q38741|SBP1_ANTMA5e-38Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding
JMSF032O02Sequence690006851 (14)sp|Q38741|SBP1_ANTMA2e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding735006851 (14)sp|Q38741|SBP1_ANTMA2e-39Squamosa-promoter binding protein 1.>pir|S62360|S62360 squamosa-promoter binding

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024G11- ATAAGATATAGGAAACTTCATCCAAA
JMFF024G11+ TTTTTTTTTTTGTTCAAGCCTCAAATGATAATAAGATATAGGAAACTTCATCCAAA
rJMFF038K23- ATAAGATATAGGAAACTTCATCCAAA
rJMFF001B20- ATATAGGAAACTTCATCCAAA
rJMFF038J19- ATAAGATATAGGAAACTTCATCCAAA
rJMFF007C15- AA
rJMSF032O02- AATGATAATAAGATATAGGAAACTTCATCCAAA
                      ____________________________________________________________
consensus TTTTTTTTTTTGTTCAAGCCTCAAATGATAATAAGATATAGGAAACTTCATCCAAA
 
. : . : . : . : . : . :
rJMFF024G11- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
JMFF024G11+ TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
rJMFF038K23- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
rJMFF001B20- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
rJMFF038J19- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
rJMFF007C15- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
rJMSF032O02- TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
JMSF032O02+ TGGGAGAGGGGATGGAGGCTGAATGAATTA
                      ____________________________________________________________
consensus TGATAATGCTCCCCTGAATCACCCTCCCACTGGGAGAGGGGATGGAGGCTGAATGAATTA
 
. : . : . : . : . : . :
rJMFF024G11- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMFF024G11+ CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
rJMFF038K23- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
rJMFF001B20- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
rJMFF038J19- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMFN038B11+ GTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMFN013E11+ GAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMFF038J19+ ACAGAAGATAGAG
rJMFF007C15- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMFF001B20+ GTCTAGCAATTGACAGAAGATAGAG
JMFF038K23+ TCTAGCAATTGACAGAAGATAGAG
rJMSF032O02- CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
JMSF032O02+ CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
                      ____________________________________________________________
consensus CAAACCACACATAGAGGCAATGATTTGTAATTGAAGTCTAGCAATTGACAGAAGATAGAG
 
. : . : . : . : . : . :
rJMFF024G11- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFF024G11+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
rJMFF038K23- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
rJMFF001B20- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
rJMFF038J19- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFN038B11+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFN013E11+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFF038J19+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
rJMFF007C15- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFF001B20+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFF038K23+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMFF007C15+ TTATGAGTT
rJMSF032O02- AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
JMSF032O02+ AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
                      ____________________________________________________________
consensus AGCATGCTAGAAATTACATTGATAAGCTATGTGGTTCAGAGACCAATCTTCTTATGAGTT
 
. : . : . : . : . : . :
rJMFF024G11- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFF024G11+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
rJMFF038K23- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
rJMFF001B20- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
rJMFF038J19- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFN038B11+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFN013E11+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFF038J19+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
rJMFF007C15- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFF001B20+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFF038K23+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMFF007C15+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
rJMSF032O02- CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
JMSF032O02+ CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
                      ____________________________________________________________
consensus CCAATAAGGAGTTGGTTTGTCCCCCCACTGGTATTACGTCTTCAGGTTGACCCTTCACCA
 
. : . : . : . : . : . :
rJMFF024G11- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFF024G11+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
rJMFF038K23- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
rJMFF001B20- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
rJMFF038J19- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFN038B11+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFN013E11+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFF038J19+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
rJMFF007C15- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFF001B20+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFF038K23+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMFF007C15+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
rJMSF032O02- CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
JMSF032O02+ CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
                      ____________________________________________________________
consensus CGAGGATCATATGTAATTCTCCTGCGGCGCTCATTGTGACCTGCCAATCGCCTCCGGCAA
 
. : . : . : . : . : . :
rJMFF024G11- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAAC---CTGCATTGCTGACAGAAG
JMFF024G11+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAAC---CTGCATTGCTGACAGAAG
rJMFF038K23- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
rJMFF001B20- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
rJMFF038J19- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFN038B11+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFN013E11+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFF038J19+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
rJMFF007C15- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFF001B20+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFF038K23+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMFF007C15+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
rJMSF032O02- CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
JMSF032O02+ CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
                      ____________________________________________________________
consensus CTCCTCTTAGCTTCATCAAACTGGGCTAATTCATGAAACCTGCTGCATTGCTGACAGAAG
 
. : . : . : . : . : . :
rJMFF024G11- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFF024G11+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
rJMFF038K23- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
rJMFF001B20- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
rJMFF038J19- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFN038B11+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFN013E11+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFF038J19+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
rJMFF007C15- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFF001B20+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFF038K23+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMFF007C15+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
rJMSF032O02- CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
JMSF032O02+ CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
                      ____________________________________________________________
consensus CGCTGTTGGACTCCATTTATAAGTACTGACGGAGCCTTTGCGTGAATCTCACAGACCTTG
 
. : . : . : . : . : . :
rJMFF024G11- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTT
JMFF024G11+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTT
rJMFF038K23- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
rJMFF001B20- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
rJMFF038J19- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFN038B11+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFN013E11+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFF038J19+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
rJMFF007C15- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFF001B20+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFF038K23+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMFF007C15+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
rJMSF032O02- TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
JMSF032O02+ TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
                      ____________________________________________________________
consensus TGGCGGCGATGGTATGGCTTGGCATCTGTCATATCTGTGGTGCAGTCTTCCACCTGACAG
 
. : . : . : . : . : . :
rJMFF038K23- AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
rJMFF001B20- AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGA
rJMFF038J19- AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFN038B11+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFN013E11+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFF038J19+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
rJMFF007C15- AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFF001B20+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFF038K23+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMFF007C15+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
rJMSF032O02- AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
JMSF032O02+ AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
                      ____________________________________________________________
consensus AACAGCTGTGTTGACCCTCCACCAGTTAACTTCCTTCCAGATAGAGTCAATGCTCTTTTC
 
. : . : . : . : . : . :
rJMFF038K23- TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
rJMFF038J19- TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFN038B11+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFN013E11+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFF038J19+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
rJMFF007C15- TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFF001B20+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFF038K23+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMFF007C15+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
rJMSF032O02- TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
JMSF032O02+ TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
                      ____________________________________________________________
consensus TTTTTGTTGTCTTCTTCAACATCTTCGTCTTCATCTTCTCCCCCCTCTGCCACCGAGTCA
 
. : . : . : . : . : . :
rJMFF038K23- GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
rJMFF038J19- GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMFN038B11+ GTTTCATTTATGCT
JMFN013E11+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMFF038J19+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
rJMFF007C15- GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMFF001B20+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMFF038K23+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMFF007C15+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
rJMSF032O02- GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
JMSF032O02+ GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
                      ____________________________________________________________
consensus GTTTCATTTATGCTTCTTTTCCCCTCTGGTTTGCTTGTTTCCATTTCTTTGATGGTAAAA
 
. : . : . : . : . : . :
rJMFF038K23- GAAGTTGGGAAGAAGTAACTCAA
rJMFF038J19- GAAGTTGGGAAGAAGTAACTCAAGCAG
JMFN013E11+ GAAGTTGGGAAGAAGTAACTCAAG
JMFF038J19+ GAAGTTGGGAAGAAGTAACTCAAGCAG
rJMFF007C15- GAAGTTGGGAAGAAGTAACTCAAGCAG
JMFF001B20+ GAAGTTGGGAAGAAGTAACTCAA
JMFF038K23+ GAAGTTGGGAAGAAGTAACTCAA
JMFF007C15+ GAAGTTGGGAAGAAGTAACTCAAGCAG
rJMSF032O02- GAAGTTGGGAAGAAGTAACTCAAGCAGGAGAAGAG
JMSF032O02+ GAAGTTGGGAAGAAGTAACTCAAGCAGGAGAAGAGAAGAAGATGAAGAATGGGAAACTTC
                      ____________________________________________________________
consensus GAAGTTGGGAAGAAGTAACTCAAGCAGGAGAAGAGAAGAAGATGAAGAATGGGAAACTTC