Previous Contig 006849:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS096E11Sequence613006849 (3)pir|D96495|D964955e-28unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892520 Arabidopsis
JMFS119A07Sequence614006849 (3)pir|D96495|D964955e-43unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892520 Arabidopsis
JMSF032N17Sequence645006849 (3)pir|D96495|D964952e-30unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892520 Arabidopsis698023546gb:AY072341_15671581e-32Arabidopsis thaliana unknown protein (At1g42550) mRNA, complete cds.>gb:BT010543

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS119A07+ TCAAAATCAGCAGCTCCTTGTGAAACTCTGGAAGGCATTGTCTGCACTGCCCCATCTC
                      ____________________________________________________________
consensus TCAAAATCAGCAGCTCCTTGTGAAACTCTGGAAGGCATTGTCTGCACTGCCCCATCTC
 
. : . : . : . : . : . :
JMFS119A07+ TGGTCTCTTTCTTCCTGACACAAACTGAGAGGCGCAGCCCGTTCATTGAAGCAGGGAGGC
JMFS096E11+ AGGCGCAGCCCGTTCATTGAAGCAGGGAGGC
JMSF032N17+ TGACACAAACTGAGAGGCGCAGCCCGTTCATTGAAGCAGGGAGGC
                      ____________________________________________________________
consensus TGGTCTCTTTCTTCCTGACACAAACTGAGAGGCGCAGCCCGTTCATTGAAGCAGGGAGGC
 
. : . : . : . : . : . :
JMFS119A07+ CTTGAACCGCCACCACTTCAACAGAGAACAGACAGCTTAGCTTCTGCTTACCAATGTGGG
JMFS096E11+ CTTGAACCGCCACCACTTCAACAGAGAACAGACAGCTTAGCTTCTGCTTACCAATGTGGG
JMSF032N17+ CTTGAACCGCCACCACTTCAACAGAGAACAGACAGCTTAGCTTCTGCTTACCAATGTGGG
                      ____________________________________________________________
consensus CTTGAACCGCCACCACTTCAACAGAGAACAGACAGCTTAGCTTCTGCTTACCAATGTGGG
 
. : . : . : . : . : . :
JMFS119A07+ AGAGAGCTCGAATCGGCTTCCAGCTCAGAAGTCCTCGTTTCTCTGAAGTATCAGCAGCTT
JMFS096E11+ AGAGAGCTCGAATCGGCTTCCAGCTCAGAAGTCCTCGTTTCTCTGAAGTATCAGCAGCTT
JMSF032N17+ AGAGAGCTCGAATCGGCTTCCAGCTCAGAAGTCCTCGTTTCTCTGAAGTATCAGCAGCTT
                      ____________________________________________________________
consensus AGAGAGCTCGAATCGGCTTCCAGCTCAGAAGTCCTCGTTTCTCTGAAGTATCAGCAGCTT
 
. : . : . : . : . : . :
JMFS119A07+ TGTCATCTAGCTTCTTAATCTCCCTCTGAGTTGCAGCCTTTGTGAGCTCCTTCTTCTTCT
JMFS096E11+ TGTCATCTAGCTTCTTAATCTCCCTCTGAGTTGCAGCCTTTGTGAGCTCCTTCTTCTTCT
JMSF032N17+ TGTCATCTAGCTTCTTAATCTCCCTCTGAGTTGCAGCCTTTGTGAGCTCCTTCTTCTTCT
                      ____________________________________________________________
consensus TGTCATCTAGCTTCTTAATCTCCCTCTGAGTTGCAGCCTTTGTGAGCTCCTTCTTCTTCT
 
. : . : . : . : . : . :
JMFS119A07+ GCTCACTCGGATCATCATCATCAAGCTTGGGCCTAGAGCGCCATGGGGACAATGACATGC
JMFS096E11+ GCTCACTCGGATCATCATCATCAAGCTTGGGCCTAGAGCGCCATGGGGACAATGACATGC
JMSF032N17+ GCTCACTCGGATCATCATCATCAAGCTTGGGCCTAGAGCGCCATGGGGACAATGACATGC
                      ____________________________________________________________
consensus GCTCACTCGGATCATCATCATCAAGCTTGGGCCTAGAGCGCCATGGGGACAATGACATGC
 
. : . : . : . : . : . :
JMFS119A07+ GCCTGGAGCGAGGCTTCGGGTTGATGATCTTCTGCTCATTCTTAACAGCAACATCGTCAT
JMFS096E11+ GCCTGGAGCGAGGCTTCGGGTTGATGATCTTCTGCTCATTCTTAACAGCAACATCGTCAT
JMSF032N17+ GCCTGGAGCGAGGCTTCGGGTTGATGATCTTCTGCTCATTCTTAACAGCAACATCGTCAT
                      ____________________________________________________________
consensus GCCTGGAGCGAGGCTTCGGGTTGATGATCTTCTGCTCATTCTTAACAGCAACATCGTCAT
 
. : . : . : . : . : . :
JMFS119A07+ CATCAGCAGCAGTAATTAAGGTAGGAGGAAGTGATGTCCTAGGAAGCACTAAGGATGCAG
JMFS096E11+ CATCAGCAGCAGTAATTAAGGTAGGAGGAAGTGATGTCCTAGGAAGCACTAAGGATGCAG
JMSF032N17+ CATCAGCAGCAGTAATTAAGGTAGGAGGAAGTGATGTCCTAGGAAGCACTAAGGATGCAG
                      ____________________________________________________________
consensus CATCAGCAGCAGTAATTAAGGTAGGAGGAAGTGATGTCCTAGGAAGCACTAAGGATGCAG
 
. : . : . : . : . : . :
JMFS119A07+ TCCTTCGAGTAGTTGAAGTGTGGGTCTGATAGAGTGATTCACTCAGGGCTTCCAGCTCTT
JMFS096E11+ TCCTTCGAGTAGTTGAAGTGTGGGTCTGATAGAGTGATTCACTCAGGGCTTCCAGCTCTT
JMSF032N17+ TCCTTCGAGTAGTTGAAGTGTGGGTCTGATAGAGTGATTCACTCAGGGCTTCCAGCTCTT
                      ____________________________________________________________
consensus TCCTTCGAGTAGTTGAAGTGTGGGTCTGATAGAGTGATTCACTCAGGGCTTCCAGCTCTT
 
. : . : . : . : . : . :
JMFS119A07+ GCAAGAGCTGTGTATTGGAATTTCTTCGGGTGGAGTAATCTGCCATAGTCTAACAGCAAT
JMFS096E11+ GCAAGAGCTGTGTATTGGAATTTCTTCGGGTGGAGTAATCTGCCATAGTCTAACAGCAAT
JMSF032N17+ GCAAGAGCTGTGTATTGGAATTTCTTCGGGTGGAGTAATCTGCCATAGTCTAACAGCAAT
                      ____________________________________________________________
consensus GCAAGAGCTGTGTATTGGAATTTCTTCGGGTGGAGTAATCTGCCATAGTCTAACAGCAAT
 
. : . : . : . : . : . :
JMFS119A07+ TCAGGGAGGAATTGAA
JMFS096E11+ TCAGGGAGGAATTGAATTGAATTGAATTTGGTAATTAAAAATGGGAATCAAATTAAAGAT
JMSF032N17+ TCAGGGAGGAATTGAATTGAATTGAATTTGGTAATTAAAAATGGGAATCAAATTAAAGAT
                      ____________________________________________________________
consensus TCAGGGAGGAATTGAATTGAATTGAATTTGGTAATTAAAAATGGGAATCAAATTAAAGAT
 
. : . : . : . : . : . :
JMFS096E11+ AGATAAACATAGAGGAGGAGCATTGGT-AAGAAGGGCGGGTTA
JMSF032N17+ AGATAAACATAGAGGAGGAGCATTGGTGAAGAAGGGCGGGTTAGGTTGATGTGTGCATTC
                      ____________________________________________________________
consensus AGATAAACATAGAGGAGGAGCATTGGTGAAGAAGGGCGGGTTAGGTTGATGTGTGCATTC