Previous Contig 006844:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032M21Sequence605006844 (2)gb:AC007048_15350998e-14Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:548006844 (2)gb:AC007048_15350996e-14Arabidopsis thaliana chromosome 2 clone F23N11 map mi148, complete sequence.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032M21+ CTGGG
JMSF032M21- CTGGG
                      ____________________________________________________________
consensus CTGGG
 
. : . : . : . : . : . :
rJMSF032M21+ GACTGAAGCAAAATTTAAAGCAAAAATGGCAATCGGTGCGGTCTCCGCCGCCACTAGATC
JMSF032M21- GACTGAAGCAAAATTTAAAGCAAAAATGGCAATCGGTGCGGTCTCCGCCGCCACTAGATC
                      ____________________________________________________________
consensus GACTGAAGCAAAATTTAAAGCAAAAATGGCAATCGGTGCGGTCTCCGCCGCCACTAGATC
 
. : . : . : . : . : . :
rJMSF032M21+ AATTTTCCGGTCGTCTGCTGTTCGTAACGCCGCCTCCAGGGTGGCATCTGAGGCCAAAGC
JMSF032M21- AATTTTCCGGTCGTCTGCTGTTCGTAACGCCGCCTCCAGGGTGGCATCTGAGGCCAAAGC
                      ____________________________________________________________
consensus AATTTTCCGGTCGTCTGCTGTTCGTAACGCCGCCTCCAGGGTGGCATCTGAGGCCAAAGC
 
. : . : . : . : . : . :
rJMSF032M21+ TGCCCGGTCCCCTTTCCGAACCGCGTCTAAAAGTCCCCTTGCTCCACGCATCTTCAGGTG
JMSF032M21- TGCCCGGTCCCCTTTCCGAACCGCGTCTAAAAGTCCCCTTGCTCCACGCATCTTCAGGTG
                      ____________________________________________________________
consensus TGCCCGGTCCCCTTTCCGAACCGCGTCTAAAAGTCCCCTTGCTCCACGCATCTTCAGGTG
 
. : . : . : . : . : . :
rJMSF032M21+ TCCAGCTGAGTTGAGCGCTTGCGTAGAGTCGTTGCAACCTTATCACACCGCCACTGCTTC
JMSF032M21- TCCAGCTGAGTTGAGCGCTTGCGTAGAGTCGTTGCAACCTTATCACACCGCCACTGCTTC
                      ____________________________________________________________
consensus TCCAGCTGAGTTGAGCGCTTGCGTAGAGTCGTTGCAACCTTATCACACCGCCACTGCTTC
 
. : . : . : . : . : . :
rJMSF032M21+ GGCTTTGATGACTTCGATGCTTACCGTTGCTCCCCGCAGCTTTGGTTGGCTTTCCGAAG
JMSF032M21- GGCTTTGATGACTTCGATGCTTACCGTTGCTCCCCGCAGCTTTGGTTGGCTTTCCGAAGC
                      ____________________________________________________________
consensus GGCTTTGATGACTTCGATGCTTACCGTTGCTCCCCGCAGCTTTGGTTGGCTTTCCGAAGC
 
. : . : . : . : . : . :
JMSF032M21- TTGCAATGATGATGTATGATCCATGTTCTGTGTCCTACAAGGGTTCCATCAAGTTTCCTG
                      ____________________________________________________________
consensus TTGCAATGATGATGTATGATCCATGTTCTGTGTCCTACAAGGGTTCCATCAAGTTTCCTG
 
. : . : . : . : . : . :
JMSF032M21- CCAGTTGCTGCCACAGCGGGTACTTATCTATGTGCGATCAGATCAAGTCATTTCCTTAGC
                      ____________________________________________________________
consensus CCAGTTGCTGCCACAGCGGGTACTTATCTATGTGCGATCAGATCAAGTCATTTCCTTAGC
 
. : . : . : . : . : . :
JMSF032M21- TACACTCGTTTTGTTAACCGTTTCCTATGGTTTAGTGCCTGCTTCAGTACAGACTGTATC
                      ____________________________________________________________
consensus TACACTCGTTTTGTTAACCGTTTCCTATGGTTTAGTGCCTGCTTCAGTACAGACTGTATC
 
. : . : . : . : . : . :
JMSF032M21- AGCCCGATAAATTTGTGAAGGAAATTTAGAGGCCATAGTTCTCATTTTTTTTCTGGTGTT
                      ____________________________________________________________
consensus AGCCCGATAAATTTGTGAAGGAAATTTAGAGGCCATAGTTCTCATTTTTTTTCTGGTGTT
 
. : . : . : . : . : . :
JMSF032M21- AAATGTGTTACCATGTGACCATTTGGATGATGATAATACAGCACATTTTCTAGTGTCTAA
                      ____________________________________________________________
consensus AAATGTGTTACCATGTGACCATTTGGATGATGATAATACAGCACATTTTCTAGTGTCTAA