Previous Contig 006843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010B07Sequence624006843 (3)pir|H86141|H861412e-23protein T25K16.15 [imported] - Arabidopsis thaliana>gb:AE005172_889167 Arabidops
JMSF032L20Sequence666006843 (3)pir|H86141|H861412e-23protein T25K16.15 [imported] - Arabidopsis thaliana>gb:AE005172_889167 Arabidops752006843 (3)pir|H86141|H861416e-21protein T25K16.15 [imported] - Arabidopsis thaliana>gb:AE005172_889167 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032L20- ATCTATTACACTGAAAA
                      ____________________________________________________________
consensus ATCTATTACACTGAAAA
 
. : . : . : . : . : . :
rJMSF032L20- TTGGTGCGGCAAAGATGAACCATCCACTGCACAACCTACAATTGAAGCCTTGCCCTGAAT
                      ____________________________________________________________
consensus TTGGTGCGGCAAAGATGAACCATCCACTGCACAACCTACAATTGAAGCCTTGCCCTGAAT
 
. : . : . : . : . : . :
rJMSF032L20- ACACATTACCAAACCACCAAACTTTGAGAGGATGTTTGTTTTGAGATCAACACAATCACA
                      ____________________________________________________________
consensus ACACATTACCAAACCACCAAACTTTGAGAGGATGTTTGTTTTGAGATCAACACAATCACA
 
. : . : . : . : . : . :
rJMSF032L20- ACCCCACACATCAAAATACCTACTTGAGGACAGGAGTCTATCAGCAGGAGCTTATTCCCT
                      ____________________________________________________________
consensus ACCCCACACATCAAAATACCTACTTGAGGACAGGAGTCTATCAGCAGGAGCTTATTCCCT
 
. : . : . : . : . : . :
rJMSF032L20- TCCACCACCGCCACCGCCTTGTCCAGGCGCCAATTTCCCTAGGCCATCACTGGAATTAGC
                      ____________________________________________________________
consensus TCCACCACCGCCACCGCCTTGTCCAGGCGCCAATTTCCCTAGGCCATCACTGGAATTAGC
 
. : . : . : . : . : . :
rJMSF032L20- CTCCAAGCCAACCTGCTTGTTTCCTCGCATATCTAGACCACTTGCACCGCTTAGTCCAGG
JMFN010B07+ AGG
JMSF032L20+ AGG
                      ____________________________________________________________
consensus CTCCAAGCCAACCTGCTTGTTTCCTCGCATATCTAGACCACTTGCACCGCTTAGTCCAGG
 
. : . : . : . : . : . :
rJMSF032L20- TCGCATAAGTTGATGCATGCCATTGTTGACTGTAGCCCCAAAACCC-GGATGGCCTTGAA
JMFN010B07+ TCGCATAAGTTGATGCATGCCATTGTTGACTGTAGCCCCAAAAACCGGGATGGCCTTGAA
JMSF032L20+ TCGCATAAGTTGATGCATGCCATTGTTGACTGTAGCCCCAAAACCC-GGATGGCCTTGAA
                      ____________________________________________________________
consensus TCGCATAAGTTGATGCATGCCATTGTTGACTGTAGCCCCAAAACCC-GGATGGCCTTGAA
 
. : . : . : . : . : . :
rJMSF032L20- ATTGTTGTTGTTGCTGCTGCTGCTGCTGAAATTGGAGCAGCTGCTGTTGTTGCTCCTGAG
JMFN010B07+ ATTGTTGTTGTTGCTGCTGCTGCTGCTGAAATTGGAGCAGCTGCTGTTGTTGCTCCTGAG
JMSF032L20+ ATTGTTGTTGTTGCTGCTGCTGCTGCTGAAATTGGAGCAGCTGCTGTTGTTGCTCCTGAG
                      ____________________________________________________________
consensus ATTGTTGTTGTTGCTGCTGCTGCTGCTGAAATTGGAGCAGCTGCTGTTGTTGCTCCTGAG
 
. : . : . : . : . : . :
rJMSF032L20- ATGGGAAACCACCGTTAAGCTGGAAGGGCAACTTCGGAACAGCAACTTGTTGCTGTGGCA
JMFN010B07+ ATGGGAAACCACCGTTAAGCTGGAAGGGCAACTTCGGAACAGCAACTTGTTGCTGTGGCA
JMSF032L20+ ATGGGAAACCACCGTTAAGCTGGAAGGGCAACTTCGGAACAGCAACTTGTTGCTGTGGCA
                      ____________________________________________________________
consensus ATGGGAAACCACCGTTAAGCTGGAAGGGCAACTTCGGAACAGCAACTTGTTGCTGTGGCA
 
. : . : . : . : . : . :
rJMSF032L20- GTGCAGTGGCTTGAGTTTGCTGCATCGGATTCCCTTGTTGAGGAACAGAACTTGGAGCCT
JMFN010B07+ GTGCAGTGGCTTGAGTTTGCTGCATCGGATTCCCTTGTTGAGGAACAGAACTTGGAGCCT
JMSF032L20+ GTGCAGTGGCTTGAGTTTGCTGCATCGGATTCCCTTGTTGAGGAACAGAACTTGGAGCCT
                      ____________________________________________________________
consensus GTGCAGTGGCTTGAGTTTGCTGCATCGGATTCCCTTGTTGAGGAACAGAACTTGGAGCCT
 
. : . : . : . : . : . :
rJMSF032L20- GTGAGGAGTTTGCTGATCCTTGTGGTTGTTGCGCATCAGCAATTGCAGCTAAATACATCA
JMFN010B07+ GTGAGGAGTTTGCTGATCCTTGTGGTTGTTGCGCATCAGCAATTGCAGCTAAATACATCA
JMSF032L20+ GTGAGGAGTTTGCTGATCCTTGTGGTTGTTGCGCATCAGCAATTGCAGCTAAATACATCA
                      ____________________________________________________________
consensus GTGAGGAGTTTGCTGATCCTTGTGGTTGTTGCGCATCAGCAATTGCAGCTAAATACATCA
 
. : . : . : . : . : . :
rJMSF032L20- GATTCTTCTGAAGAATGGCTTGATACTGTGCACATTCAGCAAGTTTCCCAAGGTTTTGAT
JMFN010B07+ GATTCTTCTGAAGAATGGCTTGATACTGTGCACATTCAGCAAGTTTCCCAAGGTTTTGAT
JMSF032L20+ GATTCTTCTGAAGAATGGCTTGATACTGTGCACATTCAGCAAGTTTCCCAAGGTTTTGAT
                      ____________________________________________________________
consensus GATTCTTCTGAAGAATGGCTTGATACTGTGCACATTCAGCAAGTTTCCCAAGGTTTTGAT
 
. : . : . : . : . : . :
rJMSF032L20- TTTCTAGTATTGCCAAAATCANATTTTTGTTATCATCCAAACACTTTTGAATCTGCTCAG
JMFN010B07+ TTTCTAGTATTGCCAAAATCAGATTTTTGTTATCATCCAAACACTTTTGAATCTGCTCAG
JMSF032L20+ TTTCTAGTATTGCCAAAATCAGATTTTTGTTATCATCCAAACACTTTTGAATCTGCTCAG
                      ____________________________________________________________
consensus TTTCTAGTATTGCCAAAATCAGATTTTTGTTATCATCCAAACACTTTTGAATCTGCTCAG
 
. : . : . : . : . : . :
rJMSF032L20- TGGTGACAGCATT
JMFN010B07+ TGGTGACAGCATTAAGCGGAAGCTGAGGAACAGAGTTGAGAGACGGGGTAGGTTGCGGCT
JMSF032L20+ TGGTGACAGCATTAAGCGGAAGCTGAGGAACAGAGTTGAGAGACGGGGTAGGTTGCGGCT
                      ____________________________________________________________
consensus TGGTGACAGCATTAAGCGGAAGCTGAGGAACAGAGTTGAGAGACGGGGTAGGTTGCGGCT
 
. : . : . : . : . : . :
JMFN010B07+ GCATTTTTTACAAGAGTCCGAGGTTGGGGTACGAGAAAACCCTGTAAAGTTCGAGAAGGG
JMSF032L20+ GCATTTTTTACAAGAGTCCGAGGTTGGGGTACGAGAAAACCCTGTAAAGTTCGAGAAGGG
                      ____________________________________________________________
consensus GCATTTTTTACAAGAGTCCGAGGTTGGGGTACGAGAAAACCCTGTAAAGTTCGAGAAGGG
 
. : . : . : . : . : . :
JMFN010B07+ ATTTGAAAATTTTTGCAGATTTACGAGAATGCAGTGCTACAAAATCGCTGGAGGGGACAG
JMSF032L20+ ATTTGAAAATTTTTGCAGATTTACGAGAATGCAGTGCTACAAAATCGCTGGAGGGGACAG
                      ____________________________________________________________
consensus ATTTGAAAATTTTTGCAGATTTACGAGAATGCAGTGCTACAAAATCGCTGGAGGGGACAG
 
. : . : . : . : . : . :
JMFN010B07+ GGGTGAGGCCGTGAGGTTTTA
JMSF032L20+ GGGTGAGGCCGTGAGGTTTTAGGGAATTAGGGCTTCGTGAAAGGAGGGAGAAGGCAGCTC
                      ____________________________________________________________
consensus GGGTGAGGCCGTGAGGTTTTAGGGAATTAGGGCTTCGTGAAAGGAGGGAGAAGGCAGCTC