Previous Contig 006837:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040J06Sequence506006837 (4)gb:AB052784_15212436e-57Glycine max mRNA for nitrate transporter NRT1-1, complete cds.725012850 (4)gb:AF428467_17993976e-52Arabidopsis thaliana AT3g47960/T17F15_170 mRNA, complete cds.
JMFS115H04Sequence624006837 (4)gb:AB052788_15212473e-87Glycine max mRNA for nitrate transporter NRT1-5, partial cds.
JMSF032J19Sequence673006837 (4)gb:AB052784_15212432e-73Glycine max mRNA for nitrate transporter NRT1-1, complete cds.744012850 (4)gb:AF428467_17993976e-52Arabidopsis thaliana AT3g47960/T17F15_170 mRNA, complete cds.
JMSF033H01Sequence705006837 (4)gb:AB052784_15212435e-87Glycine max mRNA for nitrate transporter NRT1-1, complete cds.722012850 (4)gb:AF428467_17993976e-52Arabidopsis thaliana AT3g47960/T17F15_170 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS115H04+ TCACCTTCACATATATTCTATCACCCACG
                      ____________________________________________________________
consensus TCACCTTCACATATATTCTATCACCCACG
 
. : . : . : . : . : . :
JMFS115H04+ AAGAACACAACACATGAAATCAGCATGAACAGCGCCGGAATCCCCAGTCCGATGGGCCAG
JMSF033H01+ ATGAAATCAGCATGAACAGCGCCGGAATCCCCAGTCCGATGGGCCAG
                      ____________________________________________________________
consensus AAGAACACAACACATGAAATCAGCATGAACAGCGCCGGAATCCCCAGTCCGATGGGCCAG
 
. : . : . : . : . : . :
JMFS115H04+ CTAACCTCGGATTGAATGTAAACCACCAGCGTCACCGACATCATCTGCGCGAAAGTTAAG
JMSF033H01+ CTAACCTCGGATTGAATGTAAACCACCAGCGTCACCGACATCATCTGCGCGAAAGTTAAG
JMSF032J19+ CGCGAAAGTTAAG
                      ____________________________________________________________
consensus CTAACCTCGGATTGAATGTAAACCACCAGCGTCACCGACATCATCTGCGCGAAAGTTAAG
 
. : . : . : . : . : . :
JMFS115H04+ GTGAAGAAGTACCAGTTGAAGAAGCTGTTGATGCCCCTCTTCCCTGATTCTGTCTTCGGG
JMSF033H01+ GTGAAGAAGTACCAGTTGAAGAAGCTGTTGATGCCCCTCTTCCCTGATTCTGTCTTCGGG
JMSF032J19+ GTGAAGAAGTACCAGTTGAAGAAGCTGTTGATGCCCCTCTTCCCTGATTCTGTCTTCGGG
                      ____________________________________________________________
consensus GTGAAGAAGTACCAGTTGAAGAAGCTGTTGATGCCCCTCTTCCCTGATTCTGTCTTCGGG
 
. : . : . : . : . : . :
JMFS115H04+ TTGAACTGGTCCGCCCCGAATGCCAAGTTGCACGGCCGGATTCCGGCGGCTCCCACCGTC
JMSF033H01+ TTGAACTGGTCCGCCCCGAATGCCAAGTTGCACGGCCGGATTCCGGCGGCTCCCACCGTC
JMFF040J06+ TCCGCCCCGAATGCCAAGTTGCACGGCCGGATTCCGGCGGCTCCCACCGTC
JMSF032J19+ TTGAACTGGTCCGCCCCGAATGCCAAGTTGCACGGCCGGATTCCGGCGGCTCCCACCGTC
                      ____________________________________________________________
consensus TTGAACTGGTCCGCCCCGAATGCCAAGTTGCACGGCCGGATTCCGGCGGCTCCCACCGTC
 
. : . : . : . : . : . :
JMFS115H04+ AACATGGCGAACCCGCAGAGGAGAAACCCCATCTGCCCCCTCGTCGGCTCCACGCACTCC
JMSF033H01+ AACATGGCGAACCCGCAGAGGAGAAACCCCATCTGCCCCCTCGTCGGCTCCACGCACTCC
JMFF040J06+ AACATGGCGAACCCGCAGAGGAGAAACCCCATCTGCCCCCTCGTCGGCTCCACGCACTCC
JMSF032J19+ AACATGGCGAACCCGCAGAGGAGAAACCCCATCTGCCCCCTCGTCGGCTCCACGCACTCC
                      ____________________________________________________________
consensus AACATGGCGAACCCGCAGAGGAGAAACCCCATCTGCCCCCTCGTCGGCTCCACGCACTCC
 
. : . : . : . : . : . :
JMFS115H04+ CCGCCGCCTTTTGTGCACCGCGGAGGATGCAGACTCTTCACTGCTGCCGTCAATGCTATC
JMSF033H01+ CCGCCGCCTTTTGTGCACCGCGGAGGATGCAGACTCTTCACTGCTGCCGTCAATGCTATC
JMFF040J06+ CCGCCGCCTTTTGTGCACCGCGGAGGATGCAGACTCTTCACTGCTGCCGTCAATGCTATC
JMSF032J19+ CCGCCGCCTTTTGTGCACCGCGGAGGATGCAGACTCTTCACTGCTGCCGTCAATGCTATC
                      ____________________________________________________________
consensus CCGCCGCCTTTTGTGCACCGCGGAGGATGCAGACTCTTCACTGCTGCCGTCAATGCTATC
 
. : . : . : . : . : . :
JMFS115H04+ ATCATTAATCCCAGGAAAGAATTAACGGTGGAGATTCCCAAGGTTTTGTAGCGGCCTAAG
JMSF033H01+ ATCATTAATCCCAGGAAAGAATTAACGGTGGAGATTCCCAAGGTTTTGTAGCGGCCTAAG
JMFF040J06+ ATCATTAATCCCAGGAAAGAATTAACGGTGGAGATTCCCAAGGTTTTGTAGCGGCCTAAG
JMSF032J19+ ATCATTAATCCCAGGAAAGAATTAACGGTGGAGATTCCCAAGGTTTTGTAGCGGCCTAAG
                      ____________________________________________________________
consensus ATCATTAATCCCAGGAAAGAATTAACGGTGGAGATTCCCAAGGTTTTGTAGCGGCCTAAG
 
. : . : . : . : . : . :
JMFS115H04+ TAGGTGTCACAAATGAAAGCGCCGAGGATGGTGGCGAAGTTGGTGGTTCCATTGAAGACA
JMSF033H01+ TAGGTGTCACAAATGAAAGCGCCGAGGATGGTGGCGAAGTTGGTGGTTCCATTGAAGACA
JMFF040J06+ TAGGTGTCACAAATGAAAGCGCCGAGGATGGTGGCGAAGTTGGTGGTTCCATTGAAGACA
JMSF032J19+ TAGGTGTCACAAATGAAAGCGCCGAGGATGGTGGCGAAGTTGGTGGTTCCATTGAAGACA
                      ____________________________________________________________
consensus TAGGTGTCACAAATGAAAGCGCCGAGGATGGTGGCGAAGTTGGTGGTTCCATTGAAGACA
 
. : . : . : . : . : . :
JMFS115H04+ TTGAGAAGATTCGCCGCCGTTATGTGCTTCAAGTTGAATACTGTCGTGAGGTACACTAAC
JMSF033H01+ TTGAGAAGATTCGCCGCCGTTATGTGCTTCAAGTTGAATACTGTCGTGAGGTACACTAAC
JMFF040J06+ TTGAGAAGATTCGCCGCCGTTATGTGCTTCAAGTTGAATACTGTCGTGAGGTACACTAAC
JMSF032J19+ TTGAGAAGATTCGCCGCCGTTATGTGCTTCAAGTTGAATACTGTCGTGAGGTACACTAAC
                      ____________________________________________________________
consensus TTGAGAAGATTCGCCGCCGTTATGTGCTTCAAGTTGAATACTGTCGTGAGGTACACTAAC
 
. : . : . : . : . : . :
JMFS115H04+ AGGTTGGACAGCGTGCCTATTGCTCCCAGCTTTTCGAATGTCTCGTTCCCT
JMSF033H01+ AGGTTGGACAGCGTGCCTATTGCTCCCAGCTTTTCGAATGTCTCGTTCCCTATAATGAAG
JMFF040J06+ AGGTTGGACAGCGTGCCTATTGCTCCCAGCTTTTCGAATGTCTCGTTCCCTATAATGAAG
JMSF032J19+ AGGTTGGACAGCGTGCCTATTGCTCCCAGCTTTTCGAATGTCTCGTTCCCTATAATGAAG
                      ____________________________________________________________
consensus AGGTTGGACAGCGTGCCTATTGCTCCCAGCTTTTCGAATGTCTCGTTCCCTATAATGAAG
 
. : . : . : . : . : . :
JMSF033H01+ GGCATGGCTTTGATTCCTCGGTACTTGGGCGCCGGTTCTTCAATAACCGACGACTCATCA
JMFF040J06+ GGCATGGCTTTGATTCCTCGGTACTTGGGCGCCGGTTCTTCAATAACCGACGACTCATCA
JMSF032J19+ GGCATGGCTTTGATTCCTCGGTACTTGGGCGCCGGTTCTTCAATAACCGACGACTCATCA
                      ____________________________________________________________
consensus GGCATGGCTTTGATTCCTCGGTACTTGGGCGCCGGTTCTTCAATAACCGACGACTCATCA
 
. : . : . : . : . : . :
JMSF033H01+ TGGCCGTTCATTACTGTTGTGGTTTTCTCCGCCTTCGCCGGAGATTCTCCTCCATGC
JMFF040J06+ TGGCCGTTCATTACTGTTGTGGTTTTCTCCGCCTT
JMSF032J19+ TGGCCGTTCATTACTGTTGTGGTTTTCTCCGCCTTCGCCGGAGATTCTCCTCCATGCTTA
                      ____________________________________________________________
consensus TGGCCGTTCATTACTGTTGTGGTTTTCTCCGCCTTCGCCGGAGATTCTCCTCCATGCTTA
 
. : . : . : . : . : . :
JMSF032J19+ TTATCCTCCATTTCCACTCCCATTTATGTCTTCACTCAATTTAATTTTTGTTTTCTTTTC
                      ____________________________________________________________
consensus TTATCCTCCATTTCCACTCCCATTTATGTCTTCACTCAATTTAATTTTTGTTTTCTTTTC