Previous Contig 006827:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038N01Sequence417006827 (2)gb:AP005808_18582171e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN727010014 (2)gb:AC016163_15381311e-40Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.
JMSF032H02Sequence709006827 (2)gb:AP005808_18582175e-87Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN745010014 (2)gb:AC016163_15381315e-62Arabidopsis thaliana chromosome 1 BAC F26A9 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032H02+ CTGAATCATCACCTTCATGTGATCCAGAGGCNTCATAAGTAGATATGAA
                      ____________________________________________________________
consensus CTGAATCATCACCTTCATGTGATCCAGAGGCNTCATAAGTAGATATGAA
 
. : . : . : . : . : . :
JMSF032H02+ AGCAGGATCCTCAAAAACAACATCTTCGTAAAAGCCAGCATTTGGCACATATGGATTTTC
                      ____________________________________________________________
consensus AGCAGGATCCTCAAAAACAACATCTTCGTAAAAGCCAGCATTTGGCACATATGGATTTTC
 
. : . : . : . : . : . :
JMSF032H02+ AGTTGCTTCCCAAAGTGTATCTCGATAGTAATGATTTATTCTTAAAGCTTTTCCACGCAA
                      ____________________________________________________________
consensus AGTTGCTTCCCAAAGTGTATCTCGATAGTAATGATTTATTCTTAAAGCTTTTCCACGCAA
 
. : . : . : . : . : . :
JMSF032H02+ GCCAGCTTTTAAAGCTTCAGTGCTGCTCATGGTAGTAGTCCCGACAGCTATAGGGGCAGG
                      ____________________________________________________________
consensus GCCAGCTTTTAAAGCTTCAGTGCTGCTCATGGTAGTAGTCCCGACAGCTATAGGGGCAGG
 
. : . : . : . : . : . :
JMFF038N01+ CCCTTCAGC
JMSF032H02+ ATTTCCAGGAACTAACACTGCCCATGCCTCCCCAGCTGAGAATAATGGCAACCCTTCAGC
                      ____________________________________________________________
consensus ATTTCCAGGAACTAACACTGCCCATGCCTCCCCAGCTGAGAATAATGGCAACCCTTCAGC
 
. : . : . : . : . : . :
JMFF038N01+ AGGAACATAGATGCCAGGGAACATCAAGTNTGCACCCCCAATCACAAAACGAGAAACTTC
JMSF032H02+ AGGAACATAGATGCCAGGGAACATCAAGTCTGCACCCCCAATCACAAAACGAGAAACTTC
                      ____________________________________________________________
consensus AGGAACATAGATGCCAGGGAACATCAAGTCTGCACCCCCAATCACAAAACGAGAAACTTC
 
. : . : . : . : . : . :
JMFF038N01+ ACCTCCCTTAAGCACAAAAGCAGGCAAAAGTCCTGGGACCTTCCACAGAGCATAAACTGT
JMSF032H02+ ACCTCCCTTAAGCACAAAAGCAGGCAAAAGTCCTGGGACCTTCCACAGAGCATAAACTGT
                      ____________________________________________________________
consensus ACCTCCCTTAAGCACAAAAGCAGGCAAAAGTCCTGGGACCTTCCACAGAGCATAAACTGT
 
. : . : . : . : . : . :
JMFF038N01+ GGGGAATATTTCATTGCCTCTCCCATCAATATCAAAAAACAAAGGGCAATCACCCTCCAA
JMSF032H02+ GGGGAATATTTCATTGCCTCTCCCATCAATATCAAAAAACAAAGGGCAATCACCCTCCAA
                      ____________________________________________________________
consensus GGGGAATATTTCATTGCCTCTCCCATCAATATCAAAAAACAAAGGGCAATCACCCTCCAA
 
. : . : . : . : . : . :
JMFF038N01+ ACCATATACGAGAATACGATTTGGATATTTTGAAACTGTGAACTCTGCCTTAGGAGGAAG
JMSF032H02+ ACCATATACGAGAATACGATTTGGATATTTTGAAACTGTGAACTCTGCCTTAGGAGGAAG
                      ____________________________________________________________
consensus ACCATATACGAGAATACGATTTGGATATTTTGAAACTGTGAACTCTGCCTTAGGAGGAAG
 
. : . : . : . : . : . :
JMFF038N01+ TAAAGTATCAATATCAGCATCGGATGCATTGGGGAAACGCTCTCTGATGGTCCGCCGGAG
JMSF032H02+ TAAAGTATCAATATCAGCATCGGATGCATTGGGGAAACGCTCTCTGATGGTCCGCCGGAG
                      ____________________________________________________________
consensus TAAAGTATCAATATCAGCATCGGATGCATTGGGGAAACGCTCTCTGATGGTCCGCCGGAG
 
. : . : . : . : . : . :
JMFF038N01+ CTTCTTCCGGTCTGCGCCGGAAAGTCGTTGCTGCGACTTCGCCTCGACCGTCTTCTTGAA
JMSF032H02+ CTTCTTCCGGTCTGCGCCGGAAAGTCGTTGCTGCGACTTCGCCTCGACCGTCTTCTTGAA
                      ____________________________________________________________
consensus CTTCTTCCGGTCTGCGCCGGAAAGTCGTTGCTGCGACTTCGCCTCGACCGTCTTCTTGAA
 
. : . : . : . : . : . :
JMFF038N01+ CATCTCTTCCTTCTGTAGAGTGGCGGATATGATATTTCAGTTTCGAGT
JMSF032H02+ CATCTCTTCCTTCTGTAGAGTGGCGGATATGATATTTCAGTTTCGAGTGAGAGATTCTTC
                      ____________________________________________________________
consensus CATCTCTTCCTTCTGTAGAGTGGCGGATATGATATTTCAGTTTCGAGTGAGAGATTCTTC