Previous Contig 006825:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038B15Sequence447006825 (3)gb:BT011680_16412024e-08Arabidopsis thaliana At1g28410 gene, complete cds.>gb:BT012258_1641464 Arabidops693006825 (3)gb:BT011680_16412022e-06Arabidopsis thaliana At1g28410 gene, complete cds.>gb:BT012258_1641464 Arabidops
JMSF032G08Sequence713006825 (3)gb:BT011680_16412021e-11Arabidopsis thaliana At1g28410 gene, complete cds.>gb:BT012258_1641464 Arabidops742023526gb:AC069473_15409031e-16Arabidopsis thaliana chromosome 3 BAC T21B14 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038B15- TGGTTTGATCATGAATAGTAAGTAGGACATA
                      ____________________________________________________________
consensus TGGTTTGATCATGAATAGTAAGTAGGACATA
 
. : . : . : . : . : . :
rJMFF038B15- TAAAATGAGACAGATGGAGTATATTGTAATGATTCCTAGTCGAACAAAATACTATACTGT
                      ____________________________________________________________
consensus TAAAATGAGACAGATGGAGTATATTGTAATGATTCCTAGTCGAACAAAATACTATACTGT
 
. : . : . : . : . : . :
rJMFF038B15- AACATCATAGTGAGAAGAAAAAGAATATAAGCAATAGGCAAGAAGCTAGAAGAGTTGGGC
                      ____________________________________________________________
consensus AACATCATAGTGAGAAGAAAAAGAATATAAGCAATAGGCAAGAAGCTAGAAGAGTTGGGC
 
. : . : . : . : . : . :
rJMFF038B15- ATTGTTTAATCGAACCAAACCTTTATGTTCAACTTCAGCTTTGCAGGGATCATATAACCA
                      ____________________________________________________________
consensus ATTGTTTAATCGAACCAAACCTTTATGTTCAACTTCAGCTTTGCAGGGATCATATAACCA
 
. : . : . : . : . : . :
rJMFF038B15- GTGGCACCATCTGCTGATTCAATCCACAATGCACTTGTCTTCAAATGCTTTGCAGTTTGG
                      ____________________________________________________________
consensus GTGGCACCATCTGCTGATTCAATCCACAATGCACTTGTCTTCAAATGCTTTGCAGTTTGG
 
. : . : . : . : . : . :
rJMFF038B15- TATACCCTCGACGACCATCAAAGCTTCGTTCGTTAAGCATTCAAATGGGAATACCAGTAC
                      ____________________________________________________________
consensus TATACCCTCGACGACCATCAAAGCTTCGTTCGTTAAGCATTCAAATGGGAATACCAGTAC
 
. : . : . : . : . : . :
rJMFF038B15- ACTGCATCTTCGCCTCGGGAAAATTTGCCAATGTGCAGCTAGTTCAAGTGTGATATGAGA
                      ____________________________________________________________
consensus ACTGCATCTTCGCCTCGGGAAAATTTGCCAATGTGCAGCTAGTTCAAGTGTGATATGAGA
 
. : . : . : . : . : . :
rJMFF038B15- AAGGTCAAAGCGCCTAATACTGGAAACACTACTAGAGCTGAAGCCACCAAGAATACTAAT
                      ____________________________________________________________
consensus AAGGTCAAAGCGCCTAATACTGGAAACACTACTAGAGCTGAAGCCACCAAGAATACTAAT
 
. : . : . : . : . : . :
rJMFF038B15- TCATCATTAGCAAGCACTGTCGGGAAATCATACTGTTCCACAGCCTGCTTCAGAAAGCCT
                      ____________________________________________________________
consensus TCATCATTAGCAAGCACTGTCGGGAAATCATACTGTTCCACAGCCTGCTTCAGAAAGCCT
 
. : . : . : . : . : . :
rJMFF038B15- TGCAACTGATGATGATGAAGTTTTATGGCTGCAAAGGTTTTTTCGAACTGATGCAAAGCT
                      ____________________________________________________________
consensus TGCAACTGATGATGATGAAGTTTTATGGCTGCAAAGGTTTTTTCGAACTGATGCAAAGCT
 
. : . : . : . : . : . :
rJMFF038B15- TTTGACATGTAGGAATTCTGGTCAGACGTACTGTTGGACCTCAGAAGACCCTTCAACATC
JMSF032G08+ TGTAGGAATTCTGGTCAGACGTACTGTTGGACNTCAGAAGACCCTTCAACATC
                      ____________________________________________________________
consensus TTTGACATGTAGGAATTCTGGTCAGACGTACTGTTGGACCTCAGAAGACCCTTCAACATC
 
. : . : . : . : . : . :
rJMFF038B15- TCAATATGGTGGCTGGAAAGATTTTTGATAGACTTCACAAATGGACATCTGCCATATCTT
JMSF032G08+ TCAATATGGTGGCTGGAAAGATTTTTGATAGACTTCACAAATGGACATCTGCCATATCTT
                      ____________________________________________________________
consensus TCAATATGGTGGCTGGAAAGATTTTTGATAGACTTCACAAATGGACATCTGCCATATCTT
 
. : . : . : . : . : . :
rJMFF038B15- AG
JMSF032G08+ AGTTGTGATTTCACCTTCAATACTCTAATCTCTGCCAATTGAGCAGCCTGCTCAAGTTGC
                      ____________________________________________________________
consensus AGTTGTGATTTCACCTTCAATACTCTAATCTCTGCCAATTGAGCAGCCTGCTCAAGTTGC
 
. : . : . : . : . : . :
JMSF032G08+ TGTACTTGAATCCACTGTTCATTTACAATTGCAGCTGCCTTCTCAACTTTGGAAGCAACA
                      ____________________________________________________________
consensus TGTACTTGAATCCACTGTTCATTTACAATTGCAGCTGCCTTCTCAACTTTGGAAGCAACA
 
. : . : . : . : . : . :
JMFF038B15+ CTCAGATTCTTGTGCATCGAGTGTTAGTTTATGAATTTCAAAGTTG
JMSF032G08+ TCTTTTAACCTTTCCTCAGATTCTTGTGCATCGAGTGTTAGTTTATGAATTTCAAAGTTG
                      ____________________________________________________________
consensus TCTTTTAACCTTTCCTCAGATTCTTGTGCATCGAGTGTTAGTTTATGAATTTCAAAGTTG
 
. : . : . : . : . : . :
JMFF038B15+ TTCTCTCTTGATGTAGCCCAGAGCAATTGAACCTCCTCTTCTAGAAGAGTAAGCCTTTGA
JMSF032G08+ TTCTCTCTTGATGTAGCCCAGAGCAATTGAACCTCCTCTTCTAGAAGAGTAAGCCTTTGA
                      ____________________________________________________________
consensus TTCTCTCTTGATGTAGCCCAGAGCAATTGAACCTCCTCTTCTAGAAGAGTAAGCCTTTGA
 
. : . : . : . : . : . :
JMFF038B15+ TTCTCATTTGATTCTTGGTCCTTAAAGCTTGACAAAGCAGTTTTTAGGCGGTCGATGTCA
JMSF032G08+ TTCTCATTTGATTCTTGGTCCTTAAAGCTTGACAAAGCAGTTTTTAGGCGGTCGATGTCA
                      ____________________________________________________________
consensus TTCTCATTTGATTCTTGGTCCTTAAAGCTTGACAAAGCAGTTTTTAGGCGGTCGATGTCA
 
. : . : . : . : . : . :
JMFF038B15+ AAGCTAATTTCTTCAAGTTTCTTCTCGATTCCCTCTATGTATTGGCATTTAGCATTTAAA
JMSF032G08+ AAGCTAATTTCTTCAAGTTTCTTCTCGATTCCCTCTATGTATTGGCATTTAGCATTTAAA
                      ____________________________________________________________
consensus AAGCTAATTTCTTCAAGTTTCTTCTCGATTCCCTCTATGTATTGGCATTTAGCATTTAAA
 
. : . : . : . : . : . :
JMFF038B15+ CTGTCGTCGTATTCCTCCAATGTGGATTCTAAACGGGAGAGTTTGAGCTTGGCATCTTGC
JMSF032G08+ CTGTCGTCGTATTCCTCCAATGTGGATTCTAAACGGGAGAGTTTGAGCTTGGCATCTTGC
                      ____________________________________________________________
consensus CTGTCGTCGTATTCCTCCAATGTGGATTCTAAACGGGAGAGTTTGAGCTTGGCATCTTGC
 
. : . : . : . : . : . :
JMFF038B15+ AGTTGGGTACGGAGAGAGATGTGGATCGGCGTCTGAGAGTCTCCGAGGACAGCGTTGGAG
JMSF032G08+ AGTTGGGTACGGAGAGAGATGTGGATCGGCGTCTGAGAGTCTCCGAGGACAGCGTTGGAG
                      ____________________________________________________________
consensus AGTTGGGTACGGAGAGAGATGTGGATCGGCGTCTGAGAGTCTCCGAGGACAGCGTTGGAG
 
. : . : . : . : . : . :
JMFF038B15+ TGGAGGGCGCAGAAGAGAGCTGTAAAAATGGTGGGAACCAAAATTAACGAGATTGCCATT
JMSF032G08+ TGGAGGGCGCAGAAGAGAGCTGTAAAAATGGTGGGAACCAAAATTAACGAGATTGCCATT
                      ____________________________________________________________
consensus TGGAGGGCGCAGAAGAGAGCTGTAAAAATGGTGGGAACCAAAATTAACGAGATTGCCATT
 
. : . : . : . : . : . :
JMFF038B15+ TCCAAGCCTTTCTTCTCTCAACCCTTCAGCACTGGACTTCC
JMSF032G08+ TCCAAGCCTTTCTTCTCTCAACCCTTCAGCACTGGACTTCCATTTTCACTTTTCAGCACC
                      ____________________________________________________________
consensus TCCAAGCCTTTCTTCTCTCAACCCTTCAGCACTGGACTTCCATTTTCACTTTTCAGCACC