Previous Contig 006821:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021B12Sequence642006821 (7)gb:PSU56419_17025172e-17Pisum sativum import intermediate associated protein 100 mRNA, nuclear gene enco
JMFS047F09Sequence616006821 (7)gb:PSU56419_17025172e-79Pisum sativum import intermediate associated protein 100 mRNA, nuclear gene enco
JMFS095G08Sequence626006821 (7)gb:PSU56419_17025176e-68Pisum sativum import intermediate associated protein 100 mRNA, nuclear gene enco
JMFS149F08Sequence528006821 (7)gb:AY099850_15768753e-06Arabidopsis thaliana chloroplast inner envelope protein, putative (At1g06950) mR
JMSF003N13Sequence111006821 (7)734011287 (3)pir|S71750|S717506e-65import intermediate-associated 100K protein precursor - garden pea>gb:PSIEP110_1
JMSF032G03Sequence281006821 (7)617011287 (3)pir|S71750|S717502e-38import intermediate-associated 100K protein precursor - garden pea>gb:PSIEP110_1
JMSF040G01Sequence336006821 (7)866011287 (3)pir|S71750|S717502e-77import intermediate-associated 100K protein precursor - garden pea>gb:PSIEP110_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS047F09+ CTCTAGCAAAACGACTG
                      ____________________________________________________________
consensus CTCTAGCAAAACGACTG
 
. : . : . : . : . : . :
JMFS047F09+ GCATCAGGATGGTTTTTCAATGAGATTAGCAAATTATTGAAGGCCAAAATCTTATCAAGC
                      ____________________________________________________________
consensus GCATCAGGATGGTTTTTCAATGAGATTAGCAAATTATTGAAGGCCAAAATCTTATCAAGC
 
. : . : . : . : . : . :
JMFS047F09+ TCTTCAGTGACACGTGTAGCTTCCCCGGGTGCTCTTGTCCTGGACTTCAATATGGAGACA
                      ____________________________________________________________
consensus TCTTCAGTGACACGTGTAGCTTCCCCGGGTGCTCTTGTCCTGGACTTCAATATGGAGACA
 
. : . : . : . : . : . :
JMFS047F09+ GCTCTTGATATGTTTTCTTCCACAAGCTTTCTTGTATGCTCCCTAAACATGCCTTCTGCA
                      ____________________________________________________________
consensus GCTCTTGATATGTTTTCTTCCACAAGCTTTCTTGTATGCTCCCTAAACATGCCTTCTGCA
 
. : . : . : . : . : . :
JMFS047F09+ AACTCATCAGAAAGTAGATACGAAAGCTGTGCTTCTCTGAGACTGACCAGTTGGTCCACA
                      ____________________________________________________________
consensus AACTCATCAGAAAGTAGATACGAAAGCTGTGCTTCTCTGAGACTGACCAGTTGGTCCACA
 
. : . : . : . : . : . :
JMFS047F09+ TTGACATCTCGGCCAACAGATTTAAGTTTGGAAGCATACAATCTTTGCGCATTGTCCCGA
                      ____________________________________________________________
consensus TTGACATCTCGGCCAACAGATTTAAGTTTGGAAGCATACAATCTTTGCGCATTGTCCCGA
 
. : . : . : . : . : . :
JMFS047F09+ ACAGCAACCTCAACCTGGGCATCAGTGACCTTGAACATACGTTTCCAAGGCAAAAGGAAG
JMFS095G08+ TTTCCAAGGCAAAAGGAAG
                      ____________________________________________________________
consensus ACAGCAACCTCAACCTGGGCATCAGTGACCTTGAACATACGTTTCCAAGGCAAAAGGAAG
 
. : . : . : . : . : . :
JMFS047F09+ GAAGAGGCATCTCTAAATACAATATTTGAAACATATATCAGCTTCTGGAATGCTCGTCGC
JMFS095G08+ GAAGAGGCATCTCTAAATACAATATTTGAAACATATATCAGCTTCTGGAATGCTCGTCGC
                      ____________________________________________________________
consensus GAAGAGGCATCTCTAAATACAATATTTGAAACATATATCAGCTTCTGGAATGCTCGTCGC
 
. : . : . : . : . : . :
JMFS047F09+ TGTTCTAGATCACCATCACGATCTCCTGTTTCAAGTCTTTGCCTGAAAATCCGCCTACCA
JMFS095G08+ TGTTCTAGATCACCATCACGATCTCCTGTTTCAAGTCTTTGCCTGAAAATCCGCCTACCA
                      ____________________________________________________________
consensus TGTTCTAGATCACCATCACGATCTCCTGTTTCAAGTCTTTGCCTGAAAATCCGCCTACCA
 
. : . : . : . : . : . :
JMFS047F09+ ATCTCCATATGCATAGCTGCTGCATCTGGATCATCAATGCCCAATGCATTTTTAAATTTA
JMFS095G08+ ATCTCCATATGCATAGCTGCTGCATCTGGATCATCAATGCCCAATGCATTTTTAAATTTA
                      ____________________________________________________________
consensus ATCTCCATATGCATAGCTGCTGCATCTGGATCATCAATGCCCAATGCATTTTTAAATTTA
 
. : . : . : . : . : . :
JMFS047F09+ ATGATAGTGTCCACTTCGTCGCCTCTAAGATCTTCATTTCCAGGAGGAAGGACAGCAGT
JMFS095G08+ ATGATAGTGTCCACTTCGTCGCCTCTAAGATCTTCATTTCCAGGAGGAAGGACAGCAGTT
                      ____________________________________________________________
consensus ATGATAGTGTCCACTTCGTCGCCTCTAAGATCTTCATTTCCAGGAGGAAGGACAGCAGTT
 
. : . : . : . : . : . :
JMFS095G08+ ACATACCGGCAGTATATATCACACAGCTCTGCATTGAACGCCTCGTGCTGTTTGCTGACA
JMFS021B12+ CTGTTTGCTGACA
                      ____________________________________________________________
consensus ACATACCGGCAGTATATATCACACAGCTCTGCATTGAACGCCTCGTGCTGTTTGCTGACA
 
. : . : . : . : . : . :
JMFS095G08+ CCGTACTTGTTTGCAATAGCGTCAATATCTTCCTTCTTCAAAGCTGCCGGGTCGTCACAG
JMFS021B12+ CCGTACTGTTTTGCAATAGCGTCAATATCTTCCTTCTTCAAAGCTGCCGGGTCGTCACAG
                      ____________________________________________________________
consensus CCGTACTTTTTTGCAATAGCGTCAATATCTTCCTTCTTCAAAGCTGCCGGGTCGTCACAG
 
. : . : . : . : . : . :
JMFS095G08+ CCAGCCACATAATTATGCAAATTCACGGCCGCAACCTCAGGAGCACAAGCGTTCAAAGCA
JMFS149F08+ CGCAACCTCAGGAGCACAAGCGTTCAAAGCA
JMFS021B12+ CCAGCCACATAATTATGCAAATTCACGGCCGCAACCTCAGGAGCACAAGCGTTCAAAGCA
                      ____________________________________________________________
consensus CCAGCCACATAATTATGCAAATTCACGGCCGCAACCTCAGGAGCACAAGCGTTCAAAGCA
 
. : . : . : . : . : . :
JMFS095G08+ TAAGCCGCGCCAGCGCCGGCAGCTCCAAGCGCCACAGCCCCACCCAAGCCGGCATTGCGG
JMFS149F08+ TAAGCCGCGCCAGCGCCGGCAGCTCCAAGCGCCACAGCCCCACCCAAGCCGGCATTGCGG
JMFS021B12+ TAAGCCGCGCCAGCGCCGGCAGCTCCAAGCGCCACAGCCCCACCCAAGCCGGCATTGCGG
                      ____________________________________________________________
consensus TAAGCCGCGCCAGCGCCGGCAGCTCCAAGCGCCACAGCCCCACCCAAGCCGGCATTGCGG
 
. : . : . : . : . : . :
JMFS095G08+ GACCCGCCGAACCGGAATCCGAGTCCATAACCAGCAGCGACGGCGCCGGCGAAGATAATA
JMFS149F08+ GACCCGCCGAACCGGAATCCGAGTCCATAACCAGCAGCGACGGCGCCGGCGAAGATAATA
JMFS021B12+ GACCCGCCGAACCGGAATCCGAGTTCATAACCAGCAGCGACGGCGCCGGCGAAGATAATA
                      ____________________________________________________________
consensus GACCCGCCGAACCGGAATCCGAGTCCATAACCAGCAGCGACGGCGCCGGCGAAGATAATA
 
. : . : . : . : . : . :
JMFS095G08+ GCCGAGCTCGCAATTCTAATCGGAGGCGACATGGAATCCACCAGCGCCTGGATGCCGGAC
JMFS149F08+ GCCGAGCTCGCAATTCTAATCGGAGGCGACATGGAATCCACCAGCGCCTGGATGCCGGAC
JMFS021B12+ GCCGAGCTCGCAATTCTAATCGGAGGCGACATGGAATCCACCAGCGCCTGGATGCCGGAC
                      ____________________________________________________________
consensus GCCGAGCTCGCAATTCTAATCGGAGGCGACATGGAATCCACCAGCGCCTGGATGCCGGAC
 
. : . : . : . : . : . :
JMFS095G08+ AGCTCTC
JMFS149F08+ AGCTCTCTCTTACCTCCGAACACATCCGGCTGGACAGGAATTGCAGCAGCGGCAGTGCCG
JMFS021B12+ AGCTCTCTCTTACCTCCGAACACATCCGGCTGGACAGGAATTGCAGCAGCGGCAGTGCCG
JMSF040G01+ TCCGGCTGGACCGGAATTNCNGCAGCGGCNGTNCCG
                      ____________________________________________________________
consensus AGCTCTCTCTTACCTCCGAACACATCCGGCTGGACAGGAATTGCAGCAGCGGCAGTGCCG
 
. : . : . : . : . : . :
JMFS149F08+ GCGGAAGAACTAATCGATGTTGAAGGCTGATCGGAAGAGGAGCTAACGGCGGAGATTCGA
JMFS021B12+ GCGGAAGAACTAATCGATGTTGAAGGCTGATCGGAAGAGGAGCTAACGGCGGAGATTCGA
JMSF040G01+ GCGGAANAANTNATCGATNTTGAAGGCTGATNGGAAGAGGAGCTAACGGCGGAGATTCGA
JMSF032G03+ GGAAGAGGAGCTAACNGCGGNGATTNGA
                      ____________________________________________________________
consensus GCGGAAGAACTAATCGATGTTGAAGGCTGATCGGAAGAGGAGCTAACGGCGGAGATTCGA
 
. : . : . : . : . : . :
JMFS149F08+ TAGCGGAAGTGATAGCGGTTGCGCGACGCGGCGGTGAGGCGGAGAGGGGCGGGGCTGAGG
JMFS021B12+ TAGCGGAAGTGATAGCGGTTGCGCGACGCGGCGGTGAGGCGGAGAGGGGCGGGGCTGAGG
JMSF040G01+ TAGCGGAANTNATAGCGGTTNCNCGACCCGGCNGTNAGGCGGAGAGGGGCGGGGCTGAGG
JMSF032G03+ TAGCGGAANTNATAGCGGTTTCCCGACCCGGCNGTNAGGCGGANAGGGGCGGGGCTNAGG
                      ____________________________________________________________
consensus TAGCGGAAGTGATAGCGGTTGCGCGACGCGGCGGTGAGGCGGAGAGGGGCGGGGCTGAGG
 
. : . : . : . : . : . :
JMFS149F08+ AAGGGGGAGAAGAGAGCTGTGCGGTTCGGAGATGGATTCGTTGAGAGAAGAAGCGAAGGG
JMFS021B12+ AAGGGGGAGAAGAGAGCTGTGCGGTTCGGAGATGGATTCGTTGAGAGAAGAAGCGAAGGG
JMSF040G01+ AAGGGGGAGAAGANAACTTTNCGGTTNGGAGATGGATTNGTTNAGANAAGAANCGAAGGG
JMSF003N13+ AAGCGAAGGG
JMSF032G03+ AAGGGGGAGAANANANCTTTNCGGTTTGGAGATGGATTNNTTGAGAGAAGAAGCGAAGGG
                      ____________________________________________________________
consensus AAGGGGGAGAAGAGAGCTTTGCGGTTCGGAGATGGATTCGTTGAGAGAAGAAGCGAAGGG
 
. : . : . : . : . : . :
JMFS149F08+ TTCATTGTGTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTAGGGGTTAGGGGGG
JMFS021B12+ TTCATTGTGTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTAGGGGTTAGGGGGG
JMSF040G01+ TTCNTTNTNTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTAGGGGTTAGGGGGG
JMSF003N13+ TTCCTTNTNTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTNGGGGTTNGGGGGG
JMSF032G03+ TTCNTTNTNTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTNGGGGTTNGGGGGG
                      ____________________________________________________________
consensus TTCATTGTGTGAAATGGGAAGAAGAAAAGAGAAAGGGATGGCGGGTAGGGGTTAGGGGGG
 
. : . : . : . : . : . :
JMFS149F08+ GGGGGTATAGGGTTTAA
JMFS021B12+ GGGGGTATAGGGTTTAACGGAGAGTACAG
JMSF040G01+ GGGGGTATAGGGTTTAACGGAGAGTACAGTGAGAGCCGGTAGAGGAAAATGGAAATGA
JMSF003N13+ GGGGGTATAGGGTTTAACGGAGAGTACAGTGAGAGCCGGT
JMSF032G03+ GGGGGTATAGGGTTTAACGGAGAGTACAGTGAGAGCCGGTAGAGGAAAATGGAAATGACC
                      ____________________________________________________________
consensus GGGGGTATAGGGTTTAACGGAGAGTACAGTGAGAGCCGGTAGAGGAAAATGGAAATGACC