Previous Contig 006820:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024P14Sequence514006820 (5)pir|T04232|T042322e-28pathogenesis-related protein homolog F14M19.60 - Arabidopsis thaliana>gb:ATCHRIV601006820 (5)pir|T04232|T042328e-59pathogenesis-related protein homolog F14M19.60 - Arabidopsis thaliana>gb:ATCHRIV
JMFN029M20Sequence577006820 (5)pir|T04232|T042323e-47pathogenesis-related protein homolog F14M19.60 - Arabidopsis thaliana>gb:ATCHRIV
JMSF032F24Sequence605006820 (5)pir|T04232|T042324e-48pathogenesis-related protein homolog F14M19.60 - Arabidopsis thaliana>gb:ATCHRIV580006820 (5)pir|T04232|T042324e-59pathogenesis-related protein homolog F14M19.60 - Arabidopsis thaliana>gb:ATCHRIV

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032F24- CAG
rJMFF024P14- ATACCATCATTTATGATATACAG
                      ____________________________________________________________
consensus ATACCATCATTTATGATATACAG
 
. : . : . : . : . : . :
rJMSF032F24- AAATGTAAGGAATATGATTCACATGTACATATATATGTGAGATAAATATATATATAACAC
rJMFF024P14- AAATGTAAGGAATATGATTCACATGTACATATATATGTGAGATAAATATATATATAACAC
                      ____________________________________________________________
consensus AAATGTAAGGAATATGATTCACATGTACATATATATGTGAGATAAATATATATATAACAC
 
. : . : . : . : . : . :
rJMSF032F24- TAATATGGCTTCTCACCAATATAATTCCCAGGTGGGTAGTAATTACATGTCATGAAAACA
rJMFF024P14- TAATATGGCTTCTCACCAATATAATTCCCAGGTGGGTAGTAATTACATGTCATGAAAACA
                      ____________________________________________________________
consensus TAATATGGCTTCTCACCAATATAATTCCCAGGTGGGTAGTAATTACATGTCATGAAAACA
 
. : . : . : . : . : . :
rJMSF032F24- TCACCATCATCACAAACAACCCTAGCACACCCAACTCTCATACTCTTTCTCCACACAATC
rJMFF024P14- TCACCATCATCACAAACAACCCTAGCACACCCAACTCTCACACTCTTTCTCCACACAATC
JMFN029M20+ CATCATCACAAACAACCCTAGCACACCCAACTCTCACACTCTTTCTCCACACAATC
JMSF032F24+ CCATCATCACAAACAACCCTAGCACACCCAACTCTCATACTCTTTCTCCACACAATC
                      ____________________________________________________________
consensus TCACCATCATCACAAACAACCCTAGCACACCCAACTCTCATACTCTTTCTCCACACAATC
 
. : . : . : . : . : . :
rJMSF032F24- TGAGTGTAATGCCCACAAACCTGCCCTTCAGCACAGCTATTTGCATCATAGTTATAATAC
rJMFF024P14- TGAGTGTAATGCCCACAAACCTGCCCTTCAGCACAGCTATTTGCATCATAGTTATAATAC
JMFN029M20+ TGAGTGTAATGCCCACAAACCTGCCCTTCAGCACAGCTATTTGCATCATAGTTATAATAC
JMFF024P14+ CTTCAGCACAGCTATTTGCATCATAGTTATAATAC
JMSF032F24+ TGAGTGTAATGCCCACAAACCTGCCCTTCAGCACAGCTATTTGCATCATAGTTATAATAC
                      ____________________________________________________________
consensus TGAGTGTAATGCCCACAAACCTGCCCTTCAGCACAGCTATTTGCATCATAGTTATAATAC
 
. : . : . : . : . : . :
rJMSF032F24- TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
rJMFF024P14- TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
JMFN029M20+ TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
JMFF024P14+ TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
JMSF032F24+ TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
                      ____________________________________________________________
consensus TTCTGTTCATCAGCCCAGGCCTTGACTGCATCGCCAGGGGTCCAAGTGGAGCCACTCCCC
 
. : . : . : . : . : . :
rJMSF032F24- CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
rJMFF024P14- CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
JMFN029M20+ CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
JMFF024P14+ CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
JMSF032F24+ CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
                      ____________________________________________________________
consensus CAATATATGTTCTCTCCCAGCTTGAAATCCCCTTCTGGGAAGGAGTGCATGGGGCGGCAG
 
. : . : . : . : . : . :
rJMSF032F24- TCTGCCTTTCTCTGGGCCGCCCACCACGT-GGCGTAGGCCTCCAGCTGCGGGTCCCACGC
rJMFF024P14- TCTGCCTTTCTCTGGGCCGCCCACCACGT-GGCGTAGGCCTCCAGCTGCGGGTCCCACGC
JMFN029M20+ TCTGCCTTTCTCTGGGCCGCCCACCACGT-GGCGTAGGCCTCCAGCTGCGGGTCCCACGC
JMFF024P14+ TCTGCCTTTCTCTGGGCCGCCCACCACGTGGGCGTAGGCCTCCAGCTGCGGGTCCCACGC
JMSF032F24+ TCTGCCTTTCTCTGGGCCGCCCACCACGT-GGCGTAGGCCTCCAGCTGCGGGTCCCACGC
                      ____________________________________________________________
consensus TCTGCCTTTCTCTGGGCCGCCCACCACGT-GGCGTAGGCCTCCAGCTGCGGGTCCCACGC
 
. : . : . : . : . : . :
rJMSF032F24- GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
rJMFF024P14- GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
JMFN029M20+ GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
JMFF024P14+ GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
JMSF032F24+ GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
                      ____________________________________________________________
consensus GAGTGGGGGCTCCCACTTGGATGCCCTGACTAGGTTGTGTCGGAACAGGAACTGCAGGGC
 
. : . : . : . : . : . :
rJMSF032F24- CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
rJMFF024P14- CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
JMFN029M20+ CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
JMFF024P14+ CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
JMSF032F24+ CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
                      ____________________________________________________________
consensus CTCTCCTAGGCAGTTCCAGCATAGCTGTTTGGAGATCCTGTAGATTGTGTCGTTGCTTAG
 
. : . : . : . : . : . :
rJMSF032F24- GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGG
rJMFF024P14- GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGGA
JMFN029M20+ GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGGAGGAGGAGGAGGGTGGAGATGC
JMFF024P14+ GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGGAGGAGGAGGAGGGTGGAGATGC
JMSF032F24+ GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGGAGGAGGAGGAGGGTGGAGATGC
                      ____________________________________________________________
consensus GTTTTTCATGGGGGCTGGTGATGATGATGATGAGGAGGAGGAGGAGGAGGGTGGAGATGC
 
. : . : . : . : . : . :
JMFN029M20+ CGTGGTGAGGGTGATGGTGATGAAGAGAATGAGAAGAGGGAGAAAATAATGGAGGCTTTT
JMFF024P14+ CGTGGTGAGGGTGATGGTGATGAAGAGAATGAGAAGAGGGAGAAAATAATGGAGGCTTTT
JMSF032F24+ CGTGGTGAGGGTGATGGTGATGAAGAGAATGAGAAGAGGGAGAAAATAATGGAGGCTTTT
                      ____________________________________________________________
consensus CGTGGTGAGGGTGATGGTGATGAAGAGAATGAGAAGAGGGAGAAAATAATGGAGGCTTTT
 
. : . : . : . : . : . :
JMFN029M20+ CATGTTTGGTTTGAGGAGAAAATAAAGAGGGACAGATAGATA
JMFF024P14+ CATGTTTGGTTTGAGGAGAAAATAAAGAGGGACAGATAGATAATTAATTATTCTTTGG
JMSF032F24+ CATGTTTGGTTTGAGGAGAAAATAAAGAGGGACAGATAGATAATTAATTATTCTTTGGTC
                      ____________________________________________________________
consensus CATGTTTGGTTTGAGGAGAAAATAAAGAGGGACAGATAGATAATTAATTATTCTTTGGTC