Previous Contig 006807:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS059F03Sequence621006807 (2)gb:AF283894_17830752e-23Zantedeschia aethiopica lipoxygenase (lox2) mRNA, partial cds; nuclear gene for
JMSF032E01Sequence562006807 (2)pir|B96699|B966993e-07probable lipoxygenase F12B7.11 [imported] - Arabidopsis thaliana>gb:AE005173_894712012824 (2)gb:AF283894_17830753e-67Zantedeschia aethiopica lipoxygenase (lox2) mRNA, partial cds; nuclear gene for

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS059F03+ ACCTTGACTAAAACCATGGACAACAATN
                      ____________________________________________________________
consensus ACCTTGACTAAAACCATGGACAACAATN
 
. : . : . : . : . : . :
JMFS059F03+ TGCACCAAGTACACCTCCTTGTCAAGGAAATTGGTAATCAGAGCAGCTCCTGGGCATCCA
                      ____________________________________________________________
consensus TGCACCAAGTACACCTCCTTGTCAAGGAAATTGGTAATCAGAGCAGCTCCTGGGCATCCA
 
. : . : . : . : . : . :
JMFS059F03+ AAATCCCCTGGCACCCTCAAATCAGCTGCATATTCAACTATGTATGGATTATTCTCTGAA
                      ____________________________________________________________
consensus AAATCCCCTGGCACCCTCAAATCAGCTGCATATTCAACTATGTATGGATTATTCTCTGAA
 
. : . : . : . : . : . :
JMFS059F03+ GTTTTGGGAAATCCCCTTACATAAGACCACTCTGAACTCTTCCCAGACTGGGTAACAGGA
JMSF032E01+ CTTCCCAGACTGGGTAACAGGA
                      ____________________________________________________________
consensus GTTTTGGGAAATCCCCTTACATAAGACCACTCTGAACTCTTCCCAGACTGGGTAACAGGA
 
. : . : . : . : . : . :
JMFS059F03+ TCAATGTCTTCACTGATGAGCTGAATCAAGATTCCTTTGCCAATCCCATTGATGAAAGAT
JMSF032E01+ TCAATGTCTTCACTGATGAGCTGAATCAAGATTCCTTTGCCAATCCCATTGATGAAAGAT
                      ____________________________________________________________
consensus TCAATGTCTTCACTGATGAGCTGAATCAAGATTCCTTTGCCAATCCCATTGATGAAAGAT
 
. : . : . : . : . : . :
JMFS059F03+ ACCCACTGGTCTTCAATCTTGTCAACAAGCCTCTCTCTCATCTTCTTCCTTAGAGTGATC
JMSF032E01+ ACCCACTGGTCTTCAATCTTGTCAACAAGCCTCTCTCTCATCTTCTTCCTTAGAGTGATC
                      ____________________________________________________________
consensus ACCCACTGGTCTTCAATCTTGTCAACAAGCCTCTCTCTCATCTTCTTCCTTAGAGTGATC
 
. : . : . : . : . : . :
JMFS059F03+ ACTGCCCTCACATCTATACTTGTACCAAACTCCATCAACCCCTTATTGCCCCCTTCATCT
JMSF032E01+ ACTGCCCTCACATCTATACTTGTACCAAACTCCATCAACCCCTTATTGCCCCCTTCATCT
                      ____________________________________________________________
consensus ACTGCCCTCACATCTATACTTGTACCAAACTCCATCAACCCCTTATTGCCCCCTTCATCT
 
. : . : . : . : . : . :
JMFS059F03+ AAACCTTTCTCCATCACCTTTCCAGCTGCTTCTTCCACAGTAGCCTTGCTGTCCCCACTC
JMSF032E01+ AAACCTTTCTCCATCACCTTTCCAGCTGCTTCTTCCACAGTAGCCTTGCTGTCCCCACTC
                      ____________________________________________________________
consensus AAACCTTTCTCCATCACCTTTCCAGCTGCTTCTTCCACAGTAGCCTTGCTGTCCCCACTC
 
. : . : . : . : . : . :
JMFS059F03+ CTAACCACTGCTTGTATTGTTGGCTGCCGGAGACCGGGGAATGGGGTGGCCCTTCTTCTT
JMSF032E01+ CTAACCACTGCTTGTATTGTTGGCTGCCGGAGACCGGGGAATGGGGTGGCCCTTCTTCTT
                      ____________________________________________________________
consensus CTAACCACTGCTTGTATTGTTGGCTGCCGGAGACCGGGGAATGGGGTGGCCCTTCTTCTT
 
. : . : . : . : . : . :
JMFS059F03+ GCCCGGTGGTTTCTTCCGGCACCAGAGATGACATCCGGTCGCCGGAGGTTGAGAACATGT
JMSF032E01+ GCCCGGTGGTTTCTTCCGGCACCAGAGATGACATCCGGTCGCCGGAGGTTGAGAACATGT
                      ____________________________________________________________
consensus GCCCGGTGGTTTCTTCCGGCACCAGAGATGACATCCGGTCGCCGGAGGTTGAGAACATGT
 
. : . : . : . : . : . :
JMFS059F03+ TGAATGTTTGAGCAGAAAGTTGTAGTTCTTGGTTGAACTGTTGGCATATTCTT
JMSF032E01+ TGAATGTTTGAGCAGAAAGTTGTAGTTCTTGGTTGAACTGTTGGCATATTCTTTTCTAGC
                      ____________________________________________________________
consensus TGAATGTTTGAGCAGAAAGTTGTAGTTCTTGGTTGAACTGTTGGCATATTCTTTTCTAGC
 
. : . : . : . : . : . :
JMSF032E01+ TACTCAAAACCGGATGAACACATTAAATGACTATCATTTTCTATATCTATCAAGATTTGT
                      ____________________________________________________________
consensus TACTCAAAACCGGATGAACACATTAAATGACTATCATTTTCTATATCTATCAAGATTTGT
 
. : . : . : . : . : . :
JMSF032E01+ TATACATGAGAGATAAAACATGTGGATGTGGTTGACGTTTAACAATGCTGAGTTTCGCCT
                      ____________________________________________________________
consensus TATACATGAGAGATAAAACATGTGGATGTGGTTGACGTTTAACAATGCTGAGTTTCGCCT