Previous Contig 006802:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014J07Sequence533006802 (4)gb:AF510743_18072481e-60Lycopersicon esculentum leucine aminopeptidase preprotein (LapN) mRNA, complete 687009978 (4)gb:PCLAP_16992505e-74P.crispum mRNA for leucine aminopeptidase.
JMFF038A18Sequence255006802 (4)gb:AF510743_18072489e-32Lycopersicon esculentum leucine aminopeptidase preprotein (LapN) mRNA, complete 729009978 (4)gb:PCLAP_16992503e-79P.crispum mRNA for leucine aminopeptidase.
JMSF001F08Sequence293006802 (4)gb:AF510743_18072486e-22Lycopersicon esculentum leucine aminopeptidase preprotein (LapN) mRNA, complete 719009978 (4)gb:PCLAP_16992501e-85P.crispum mRNA for leucine aminopeptidase.
JMSF032D04Sequence676006802 (4)gb:AF510743_18072484e-64Lycopersicon esculentum leucine aminopeptidase preprotein (LapN) mRNA, complete 772009978 (4)gb:PCLAP_16992503e-96P.crispum mRNA for leucine aminopeptidase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032D04+ TCTTCGAAAATCCCCA
                      ____________________________________________________________
consensus TCTTCGAAAATCCCCA
 
. : . : . : . : . : . :
JMSF032D04+ GCACAGTTCCGGTTGCTATTGCTGAGGCAGTACTGAGCTTTGATTCCGAAGAGAGGCCTT
                      ____________________________________________________________
consensus GCACAGTTCCGGTTGCTATTGCTGAGGCAGTACTGAGCTTTGATTCCGAAGAGAGGCCTT
 
. : . : . : . : . : . :
JMFF014J07+ GAAGCAAGTGCAACAGCAATACTACTTGCCTGAGCAGATTTAGCAGCTGCAGCAA
JMSF032D04+ CGGCTGAAGCAAGTGCAACAGCAATACTACTTGCCTGAGCAGATTTAGCAGCTGCAGCAA
                      ____________________________________________________________
consensus CGGCTGAAGCAAGTGCAACAGCAATACTACTTGCCTGAGCAGATTTAGCAGCTGCAGCAA
 
. : . : . : . : . : . :
JMFF014J07+ TAGTCTCACCGAGAGTACGATAAGCAGTGGTTGAAGAAACTGCTGATCCAAGCCCAACTA
JMSF032D04+ TAGTCTCACCGAGAGTACGATAAGCAGTGGTTGAAGAAACTGCTGATCCAAGCCCAACTA
                      ____________________________________________________________
consensus TAGTCTCACCGAGAGTACGATAAGCAGTGGTTGAAGAAACTGCTGATCCAAGCCCAACTA
 
. : . : . : . : . : . :
JMFF038A18+ GAACCAAGACCAGGAAGTCTAAGAACAGTGGATTGCCCAGATTTCC
JMFF014J07+ ACCCAATCCTTTTAGAACCAAGACCAGGAAGTCTAAGAACAGTGGATTGCCCAGATTTCC
JMSF032D04+ ACCCAATCCTTTTAGAACCAAGACCAGGAAGTCTAAGAACAGTGGATTGCCCAGATTTCC
                      ____________________________________________________________
consensus ACCCAATCCTTTTAGAACCAAGACCAGGAAGTCTAAGAACAGTGGATTGCCCAGATTTCC
 
. : . : . : . : . : . :
JMFF038A18+ CAGAAAAATCTTCCTCGGAGGAGGCTTCGGACAGCAAACCACCCAATTTTGAATCCAACT
JMFF014J07+ CAGAAAAATCTTCCTCGGAGGAGGCTTCGGACAGCAAACCACCCAATTTTGAATCCAACT
JMSF032D04+ CAGAAAAATCTTCCTCGGAGGAAGCTTCGGACAGCAAACCACCCAATTTTGAATCCAACT
                      ____________________________________________________________
consensus CAGAAAAATCTTCCTCGGAGGAGGCTTCGGACAGCAAACCACCCAATTTTGAATCCAACT
 
. : . : . : . : . : . :
JMFF038A18+ TTTGCAAGATCAAATTTTGGAACTTGGAATTTTCGTCTTTAACCATGTCCTTCTCTGTTA
JMFF014J07+ TTTGCAAGATCAAATTTTGGAACTTGGAATTTTCGTCTTTAACCATGTCCTTCTCTGTTA
JMSF032D04+ TTTGCAAGATCAAATTTTGGAACTTGGAATTTTCGTCTTTAACCATGTCCTTCTCTGTTA
                      ____________________________________________________________
consensus TTTGCAAGATCAAATTTTGGAACTTGGAATTTTCGTCTTTAACCATGTCCTTCTCTGTTA
 
. : . : . : . : . : . :
JMFF038A18+ CACCCACTGCAAGGATATCTCCTTTCCATTCAAGCAAATCAACCTCTTTTGCAGCAAATG
JMFF014J07+ CACCCACTGCAAGGATATCTCCTTTCCATTCAAGCAAATCAACCTCTTTTGCAGCAAATG
JMSF001F08+ ACTGCAAGGATATCTCCTTTCCATTCAAGCAAATCAACNTCTTTTGCAGCAAATG
JMSF032D04+ CACCCACTGCAAGGATATCTCCTTTCCATTCAAGCAAATCAACCTCTTTTGCAGCAAATG
                      ____________________________________________________________
consensus CACCCACTGCAAGGATATCTCCTTTCCATTCAAGCAAATCAACCTCTTTTGCAGCAAATG
 
. : . : . : . : . : . :
JMFF038A18+ ATATCTTGGGGCGTTCGATTCGATTGGGA
JMFF014J07+ ATATCTTGGGGCGTTCGATTTGATTGGGATGAGTGAGGCCAAGAGTGGCCCGAGCTATGG
JMSF001F08+ ATATCTTGGGGCGTTCGATTTGATTGGGATGAGTGAGGCCAAGAGTGGCCCGAGCTATGG
JMSF032D04+ ATATCTTGGGGCGTTCGATTTGATTGGGATGAGTGAGGCCAAGAGTGGCCCGAGCTATGG
                      ____________________________________________________________
consensus ATATCTTGGGGCGTTCGATTTGATTGGGATGAGTGAGGCCAAGAGTGGCCCGAGCTATGG
 
. : . : . : . : . : . :
JMFF014J07+ AGTGCGCCATACGCCTAGGTCTTCTGCAGCAGAGGGGCGAAACCGAGAAGGAAATAGCCC
JMSF001F08+ AGTGCGCCATACGCCTAGGTCTTCTGCAGCAGAGGGGCGAAACCGAGAAGGAAATAGCCC
JMSF032D04+ AGTGCGCCATACGCCTAGGTCTTCTGCAGCAGAGGGGCGAAACCGAGAAGGAAATAGCCC
                      ____________________________________________________________
consensus AGTGCGCCATACGCCTAGGTCTTCTGCAGCAGAGGGGCGAAACCGAGAAGGAAATAGCCC
 
. : . : . : . : . : . :
JMFF014J07+ AGGCGGAGGTAGATCGGAATTTCAAGAAAATGGAAGAAGTAGAAGTGGAAGTAGAT
JMSF001F08+ AGGCGGAGGTAGATCGGAATTTCAAGAAAATGGAAGAAGTAGAAGTGGAAGTAGATGTGG
JMSF032D04+ AGGCGGAGGTAGATCGGAATTTCAAGAAAATGGAAGAAGTAGAAGTGGAAGTAGATGTGG
                      ____________________________________________________________
consensus AGGCGGAGGTAGATCGGAATTTCAAGAAAATGGAAGAAGTAGAAGTGGAAGTAGATGTGG
 
. : . : . : . : . : . :
JMSF001F08+ AAACGGCAGCGACCGCGATATTAGTAGCCAAAACTGAGGATCTCAAACTCAAAGC
JMSF032D04+ AAACGGCAGCGACCGCGATATTAGTAGCCAAAACTGAGGATCTCAAACTCAAAGCGGCCC
                      ____________________________________________________________
consensus AAACGGCAGCGACCGCGATATTAGTAGCCAAAACTGAGGATCTCAAACTCAAAGCGGCCC