Previous Contig 006801:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN032F11Sequence589006801 (18)gb:AB028611_15179422e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.
JMFS071H01Sequence612006801 (18)gb:AB028611_15179422e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.
JMFS096H01Sequence597006801 (18)gb:AB028611_15179422e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.
JMSF009C02Sequence363006801 (18)gb:AB028611_15179429e-26Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.715006801 (18)gb:BT014785_16417753e-07Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops
JMSF013L11Sequence508006801 (18)gb:AB028611_15179421e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.702006801 (18)gb:BT014785_16417751e-04Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops
JMSF014J03Sequence250006801 (18)gb:AB028611_15179424e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.717006801 (18)gb:BT014785_16417751e-06Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops
JMSF015B11Sequence437006801 (18)gb:AB028611_15179426e-35Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.767006801 (18)gb:BT014785_16417753e-10Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops
JMSF032C24Sequence688006801 (18)gb:AB028611_15179422e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.548006801 (18)
JMSF033C24Sequence120006801 (18)
JMSF037B01Sequence684006801 (18)gb:AB028611_15179423e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.717006801 (18)gb:BT014785_16417753e-07Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops
JMSF052K04Sequence704006801 (18)gb:AB028611_15179423e-33Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.927006801 (18)gb:AB028611_15179424e-33Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014J03- TATCGGTTATAT
rJMSF037B01- TATCGGTTATAT
rJMSF013L11- TATCGGTTATAT
rJMSF032C24- TATCGGTTATAT
rJMSF009C02- TATCGGTTATAT
rJMSF015B11- AAATGAATGGAAAATTATCGGTTATAT
                      ____________________________________________________________
consensus AAATGAATGGAAAATTATCGGTTATAT
 
. : . : . : . : . : . :
rJMSF014J03- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF037B01- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF013L11- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF032C24- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF009C02- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF015B11- ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
rJMSF052K04- AGAGACTTGCAAGGGTGACTGAACAACTACTCA
                      ____________________________________________________________
consensus ACAATTAGCTTGCAAGAAAAGGAAACAAGAGACTTGCAAGGGTGACTGAACAACTACTCA
 
. : . : . : . : . : . :
rJMSF014J03- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF037B01- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF013L11- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF032C24- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF009C02- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF015B11- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
rJMSF052K04- CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
                      ____________________________________________________________
consensus CCAGTCACTATCATATTTCTAAGGTCCCAAAACTAAACTTGACTATAAATTGCCAAGGAT
 
. : . : . : . : . : . :
rJMSF014J03- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF037B01- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF013L11- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF032C24- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF009C02- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF015B11- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
rJMSF052K04- GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
                      ____________________________________________________________
consensus GGATTAACAAAAAACACCAATCCCAAAACACTTCTTATATCATATGGAGTACATATGTTC
 
. : . : . : . : . : . :
rJMSF014J03- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF037B01- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF013L11- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF032C24- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF009C02- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF015B11- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
rJMSF052K04- TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
                      ____________________________________________________________
consensus TACTCTTATGCTTTTGCAGGTTCCTTGGATATGTTCTGTAGTATATCAATTTCATATTTA
 
. : . : . : . : . : . :
rJMSF014J03- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF037B01- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF013L11- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF032C24- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF009C02- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF015B11- GTAGTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
rJMSF052K04- GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
                      ____________________________________________________________
consensus GTACTCCATAGACCATAGTCCTTATATATGTTCAATAAAAGTTTGCCTTCTTTTTCTTAA
 
. : . : . : . : . : . :
rJMSF014J03- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF037B01- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF013L11- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF032C24- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF009C02- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF015B11- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
rJMSF052K04- GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
JMSF052K04+ CTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
JMSF037B01+ GGATCAAGTAAATATGGCCAGTGT
JMSF032C24+ TGGTGGATCAAGTAAATATGGCCAGTGT
                      ____________________________________________________________
consensus GTTCCAGCTTCCATTACTGCCAGTAATTTCCATGGTGGATCAAGTAAATATGGCCAGTGT
 
. : . : . : . : . : . :
rJMSF014J03- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
rJMSF037B01- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
rJMSF013L11- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
rJMSF032C24- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
rJMSF009C02- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
JMSF033C24+ CTCG
rJMSF015B11- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
rJMSF052K04- TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
JMSF052K04+ TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
JMFS071H01+ CACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
JMFN032F11+ TCATAACTCG
JMFS096H01+ GTTTCTCATAACTCG
JMSF037B01+ TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
JMSF032C24+ TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
                      ____________________________________________________________
consensus TTCCAGCACCAAGGTGGTGGGCACACTGAGGAGGTCTTCCACCACGTTTCTCATAACTCG
 
. : . : . : . : . : . :
rJMSF014J03- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
rJMSF037B01- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
rJMSF013L11- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
rJMSF032C24- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
rJMSF009C02- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMSF033C24+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGNTA
rJMSF015B11- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
rJMSF052K04- GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMSF052K04+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMFS071H01+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMFN032F11+ GAGACATCACTGAGAGATTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMFS096H01+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMSF037B01+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
JMSF032C24+ GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
                      ____________________________________________________________
consensus GAGACATCACTGAGAGCTTCGACATCTGATGGATGCCCTTCCCACCACGAGACGATGCTA
 
. : . : . : . : . : . :
rJMSF014J03- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
rJMSF037B01- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
rJMSF013L11- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
rJMSF032C24- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAG
rJMSF009C02- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMSF033C24+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGNGACATAGAGCTATTNCTAGTAGAG
rJMSF015B11- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
rJMSF052K04- AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMSF052K04+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMFS071H01+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMFN032F11+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMFS096H01+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMSF013L11+ TGACATAGAGCTATTGCTAGTAGAGGAAG
JMSF037B01+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
JMSF032C24+ AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
                      ____________________________________________________________
consensus AGAATCTTGGAGCAGTGCAGGGTAATCTTGGTGACATAGAGCTATTGCTAGTAGAGGAAG
 
. : . : . : . : . : . :
rJMSF014J03- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
rJMSF037B01- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
rJMSF013L11- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
rJMSF009C02- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
rJMSF015B11- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
rJMSF052K04- AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMSF052K04+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMFS071H01+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMFN032F11+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMFS096H01+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMSF013L11+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMSF015B11+ TCGGCGGCGAAAGGAAAG
JMSF037B01+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
JMSF032C24+ AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
                      ____________________________________________________________
consensus AAGCAGTTGAGAGCGGAGGAGGAGAGCCCTTTTTGGTGGATTTCGGCGGCGAAAGGAAAG
 
. : . : . : . : . : . :
rJMSF014J03- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
rJMSF037B01- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
rJMSF013L11- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCTTCAT
rJMSF009C02- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
rJMSF015B11- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
rJMSF052K04- CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTAGCGAGATCCTCAT
JMSF052K04+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTAGCGAGATCCTCAT
JMFS071H01+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
JMFN032F11+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
JMFS096H01+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
JMSF009C02+ CAT
JMSF013L11+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCTTCAT
JMSF015B11+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
JMSF037B01+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
JMSF032C24+ CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
                      ____________________________________________________________
consensus CTCTAATCTTGATGGACCCGCAGCGATCATATTCCTCGATGAGATTGGCGAGATCCTCAT
 
. : . : . : . : . : . :
rJMSF014J03- CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGA
rJMSF037B01- CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAG
rJMSF013L11- CGGAAGTTATGGACACCAACGCGTCCAAGT
rJMSF009C02- CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAG
rJMSF015B11- CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
rJMSF052K04- CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF052K04+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMFS071H01+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMFN032F11+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMFS096H01+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF009C02+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF013L11+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF015B11+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF037B01+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
JMSF032C24+ CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGAGAGCTGACACCTTAGACTCA
                      ____________________________________________________________
consensus CGGAAGTTATGGACACCAACGCGTCCAAGTCTTCAGCTGGGAGCTGACACCTTAGACTCA
 
. : . : . : . : . : . :
rJMSF015B11- CCGATGCTCCATACATTTCC
rJMSF052K04- CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF052K04+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMFS071H01+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMFN032F11+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMFS096H01+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF014J03+ ATGGAGCGAT
JMSF009C02+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF013L11+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF015B11+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF037B01+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
JMSF032C24+ CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
                      ____________________________________________________________
consensus CCGATGCTCCATACATTTCCCCGAGCTTCACCAGCAGCTTGGAAAAAGAGATGGAGCGAT
 
. : . : . : . : . : . :
rJMSF052K04- CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF052K04+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMFS071H01+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMFN032F11+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMFS096H01+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF014J03+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF009C02+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF013L11+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF015B11+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF037B01+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
JMSF032C24+ CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
                      ____________________________________________________________
consensus CAACGGACAGGACCCGGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGGTGACGTG
 
. : . : . : . : . : . :
rJMSF052K04- GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF052K04+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMFS071H01+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMFN032F11+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMFS096H01+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF014J03+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF009C02+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF013L11+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF015B11+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF037B01+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
JMSF032C24+ GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
                      ____________________________________________________________
consensus GGAGAATCTTGCCGCCGTAGCTACAGAGGAATTTGATGGATTTTGTAGAAGAAGGTCCAG
 
. : . : . : . : . : . :
rJMSF052K04- CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAANCTATAT
JMSF052K04+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMFS071H01+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMFN032F11+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMFS096H01+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF014J03+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF009C02+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF013L11+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF015B11+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF037B01+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
JMSF032C24+ CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
                      ____________________________________________________________
consensus CCATGTCCGTCTCCTCGCTCTTCGGAGATACAAAGGAGAATGGTAAAACTATATGCAGTG
 
. : . : . : . : . : . :
JMSF052K04+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTT
JMFS071H01+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGAT
JMFN032F11+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTC
JMFS096H01+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTT
JMSF014J03+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTT
JMSF009C02+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTT
JMSF013L11+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTTC
JMSF015B11+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTTC
JMSF037B01+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTTC
JMSF032C24+ AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTTCA
                      ____________________________________________________________
consensus AAGAAGAAGAAGAAAAGAAGAAAGGCTTTGAAGATTCTCTTTTCTTTACTGGCTTCTTCA