Previous Contig 006800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001D06Sequence501006800 (3)gb:AY057642_15640551e-56Arabidopsis thaliana AT5g36230/T30G6_9 mRNA, complete cds.>gb:AY136473_1581973 A663020642gb:BT004814_16378482e-04Arabidopsis thaliana At5g41270 gene, complete cds.
JMSF032C22Sequence689006800 (3)gb:AY057642_15640553e-93Arabidopsis thaliana AT5g36230/T30G6_9 mRNA, complete cds.>gb:AY136473_1581973 A545006800 (3)gb:AY057642_15640551e-58Arabidopsis thaliana AT5g36230/T30G6_9 mRNA, complete cds.>gb:AY136473_1581973 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032C22- GTACAG
                      ____________________________________________________________
consensus GTACAG
 
. : . : . : . : . : . :
rJMSF032C22- TAATGATCNCAATCTTGATCTCTNCTNCATAACGCTTCCTCTGCAATCTGAGTCGTTAAT
                      ____________________________________________________________
consensus TAATGATCNCAATCTTGATCTCTNCTNCATAACGCTTCCTCTGCAATCTGAGTCGTTAAT
 
. : . : . : . : . : . :
rJMSF032C22- GCAGTTTTCATTTCTTTGAGTTTCNCCNCAAAAATCTTCTTCTTGTAGNATTCTACCAAA
                      ____________________________________________________________
consensus GCAGTTTTCATTTCTTTGAGTTTCNCCNCAAAAATCTTCTTCTTGTAGNATTCTACCAAA
 
. : . : . : . : . : . :
rJMSF032C22- GGTAANAGGTCCTCCTTGGNGAAANGTTCNTAGAANGCTTCAGGTGNCCTCTTTGAAGAC
                      ____________________________________________________________
consensus GGTAANAGGTCCTCCTTGGNGAAANGTTCNTAGAANGCTTCAGGTGNCCTCTTTGAAGAC
 
. : . : . : . : . : . :
rJMSF032C22- GGGAAGAATTCAAGAAAATTGTCATCAACTTTACCCCGCTTAANAATTGATATCAGATCA
                      ____________________________________________________________
consensus GGGAAGAATTCAAGAAAATTGTCATCAACTTTACCCCGCTTAANAATTGATATCAGATCA
 
. : . : . : . : . : . :
rJMSF032C22- TCAAGACTGTTGTCNACCAAATATNCCTTGAAAAAGTCAGTGATGAANGANAGAACTAGC
JMSF032C22+ AAAAGTCAGTGATGAATGAGAGAACTAGC
                      ____________________________________________________________
consensus TCAAGACTGTTGTCNACCAAATATNCCTTGAAAAAGTCAGTGATGAATGAGAGAACTAGC
 
. : . : . : . : . : . :
rJMSF032C22- CCTTTGGCAACAAGGTTATCTTTGAGCAGTGGTTGGAACACAGTTTCTGGTGGGAGCCCT
JMSF032C22+ CCTTTGGCAACAAGGTTATCTTTGAGCAGTGGTTGGAACACAGTTTCTGGTGGGAGCCCT
                      ____________________________________________________________
consensus CCTTTGGCAACAAGGTTATCTTTGAGCAGTGGTTGGAACACAGTTTCTGGTGGGAGCCCT
 
. : . : . : . : . : . :
rJMSF032C22- GACAACTTCNGAGAAAATGCAAGGGCTGTAAAAATTGCNAGCTTCTTTCTTTCATTATCC
JMSF032C22+ GACAACTTCTGAGAAAATGCAAGGGCTGTAAAAATTGCGAGCTTCTTTCTTTCATTATCC
                      ____________________________________________________________
consensus GACAACTTCTGAGAAAATGCAAGGGCTGTAAAAATTGCGAGCTTCTTTCTTTCATTATCC
 
. : . : . : . : . : . :
rJMSF032C22- TCAAAGAGTTCCAATGNCTGTAAGAATCTTCGCNTAACATTTTCAAGATTCTTTATAAGA
JMFF001D06+ CGCATAACATTTTCAAGGTTCTTTATAAGA
JMSF032C22+ TCAAAGAGTTCCAATGACTGTAAGAATCTTCGCATAACATTTTCAAGATTCTTTATAAGA
                      ____________________________________________________________
consensus TCAAAGAGTTCCAATGACTGTAAGAATCTTCGCATAACATTTTCAAGATTCTTTATAAGA
 
. : . : . : . : . : . :
rJMSF032C22- ANTGGCTTTCTTCGTAGGATCNTCTGTATATAGATTACNGATGGAAGAATGGCTTC
JMFF001D06+ AATGGCTTTCGCCTTAAGATCTTTTGCACGTAGATTACAGATGGCAAAATGAATTCGCGC
JMSF032C22+ AATGGCTTTCTTCGTAGGATCTTCTGTATATAGATTACAGATGGAAGAATGGCTTCACGC
                      ____________________________________________________________
consensus AATGGCTTTCTTCGTAGGATCTTCTGTATATAGATTACAGATGGAAGAATGGCTTCGCGC
 
. : . : . : . : . : . :
JMFF001D06+ TCTGGCTGACACTCAATTACAGAGTAAGGGTGGCGCTCCCCCTCATCCGGTTTAACTGTT
JMSF032C22+ TTAGGTTCACACTCAATTACAGAATAAGGGTGGCGCTCCCCCTCATCAGGTTTGATTGTT
                      ____________________________________________________________
consensus TTTGGTTGACACTCAATTACAGAGTAAGGGTGGCGCTCCCCCTCATCCGGTTTGATTGTT
 
. : . : . : . : . : . :
JMFF001D06+ CCAGGTTGAGTACGACCTCCTGTGAATACAACCTCAAAAAAAGTGTCACCGTATCTAGAG
JMSF032C22+ CCAGGTTGTGTGCGGCCTCCTGTGAAAACAACCTCAAAAAAGGTATCACCGTATCTTGAG
                      ____________________________________________________________
consensus CCAGGTTGTGTGCGGCCTCCTGTGAATACAACCTCAAAAAAGGTGTCACCGTATCTTGAG
 
. : . : . : . : . : . :
JMFF001D06+ AAGTTAAGTTCTGATGACTCAATGCTCTTAGCAACGAGTTCCAGATCACCAGCATTATCC
JMSF032C22+ AAGTTAAGCTCTGAAGACTCGACGCTCTTAGCAACAAGTTCCAGATCACCAGCATTATCC
                      ____________________________________________________________
consensus AAGTTAAGTTCTGATGACTCGATGCTCTTAGCAACGAGTTCCAGATCACCAGCATTATCC
 
. : . : . : . : . : . :
JMFF001D06+ AAATAGATCTGGACCACTGCATCCGCAAATGCTGCAGGGTCCAGCGGCGCTGCAATATTC
JMSF032C22+ AGATATATCTGGATCACTACATCTGCAAATGCTGCAGGGTCCAGAGGCGCAGCAATATTC
                      ____________________________________________________________
consensus AGATATATCTGGATCACTGCATCTGCAAATGCTGCAGGGTCCAGCGGCGCTGCAATATTC
 
. : . : . : . : . : . :
JMFF001D06+ CGTTTGCGGGTCTTAATCCGCGTGCCACCTAGAGTGGGTTTCTCCTTCGAGCTCATAAAC
JMSF032C22+ CGTTTGCGGGTCTTAATCCGCGTGCCACCTAGAGTGGGTTTCTCCTTTGAGCTCATAAAC
                      ____________________________________________________________
consensus CGTTTGCGGGTCTTAATCCGCGTGCCACCTAGAGTGGGTTTCTCCTTTGAGCTCATAAAC
 
. : . : . : . : . : . :
JMFF001D06+ CAAGATCGAAAAGAATCGAAGTACAGGCAGAGACCCTCTGC
JMSF032C22+ CAAGATCGAGATGAATCGGTGTAGAGGCGGACACCCTCTGCTACGCTACTCGCGACGCAA
                      ____________________________________________________________
consensus CAAGATCGAGATGAATCGGTGTAGAGGCGGAGACCCTCTGCTACGCTACTCGCGACGCAA
 
. : . : . : . : . : . :
JMSF032C22+ AGTACGAAGAGGAGAGAAATGGGAAAGAAAAGGAAAAGAGAGAGAGAGATTGATTCCCCC
                      ____________________________________________________________
consensus AGTACGAAGAGGAGAGAAATGGGAAAGAAAAGGAAAAGAGAGAGAGAGATTGATTCCCCC