Previous Contig 006790:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032B11Sequence621006790 (2)gb:AX647813_14725345e-04Sequence 2005 from Patent EP1270724.567006790 (2)gb:AX647813_14725344e-04Sequence 2005 from Patent EP1270724.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032B11- GGCTGAAGATTCAAGGCCAAA
                      ____________________________________________________________
consensus GGCTGAAGATTCAAGGCCAAA
 
. : . : . : . : . : . :
JMSF032B11- ACAAGAGATGGAGAGACATTCAATCAAGCTGCTGCTCTTACTAGCCTTTTTCATGGTTGC
                      ____________________________________________________________
consensus ACAAGAGATGGAGAGACATTCAATCAAGCTGCTGCTCTTACTAGCCTTTTTCATGGTTGC
 
. : . : . : . : . : . :
JMSF032B11- ATCTTGTTAGTTCTCTCTCTCCCTGTGTCTACACACACACACACATATATATATATACTG
                      ____________________________________________________________
consensus ATCTTGTTAGTTCTCTCTCTCCCTGTGTCTACACACACACACACATATATATATATACTG
 
. : . : . : . : . : . :
rJMSF032B11+ T
JMSF032B11- CCTTTATTTATCCATATTTGGATTAACATAAATTATGATTAAGTGAGATTATTTATACAT
                      ____________________________________________________________
consensus CCTTTATTTATCCATATTTGGATTAACATAAATTATGATTAAGTGAGATTATTTATACAT
 
. : . : . : . : . : . :
rJMSF032B11+ GTTGCAGTGTTGCCATCAATTATGATGGCACAGGTAAGTGTAGGACCAAACAAGAAGCAA
JMSF032B11- GTTGCAGTGTTGCCATCAATTATGATGGCACAGGTAAGTGTAGGACCAAACAAGAAGCAA
                      ____________________________________________________________
consensus GTTGCAGTGTTGCCATCAATTATGATGGCACAGGTAAGTGTAGGACCAAACAAGAAGCAA
 
. : . : . : . : . : . :
rJMSF032B11+ TTGTTTATGACTGGGCAGCTTTGCAAGTCTCATGATGACTGCAAAGCCAATAGTGTATAC
JMSF032B11- TTGTTTATGACTGGGCAGCTTTGCAAGTCTCATGATGACTGCAAAGCCAATAGTGTATAC
                      ____________________________________________________________
consensus TTGTTTATGACTGGGCAGCTTTGCAAGTCTCATGATGACTGCAAAGCCAATAGTGTATAC
 
. : . : . : . : . : . :
rJMSF032B11+ TCAACCAACTTCTGCATCAACGAAATCTCTGGATCTGAAATCGGTCATTGTGTTGGATTT
JMSF032B11- TCAACCAACTTCTGCATCAACGAAATCTCTGGATCTGAAATCGGTCATTGTGTTGGATTT
                      ____________________________________________________________
consensus TCAACCAACTTCTGCATCAACGAAATCTCTGGATCTGAAATCGGTCATTGTGTTGGATTT
 
. : . : . : . : . : . :
rJMSF032B11+ GACTCCACTTTGGAAATGGTGGTGAAGAAAAGCAAGGCAAAGGAGGGTGGTTGTGGGAAG
JMSF032B11- GACTCCACTTTGGAAATGGTGGTGAAGAAAAGCAAGGCAAAGGAGGGTGGTTGTGGGAAG
                      ____________________________________________________________
consensus GACTCCACTTTGGAAATGGTGGTGAAGAAAAGCAAGGCAAAGGAGGGTGGTTGTGGGAAG
 
. : . : . : . : . : . :
rJMSF032B11+ TGTGAAACCGACGACGATTGCAAGAATTGTCCAGCAGCAGCTAGTTGCGAGAAATATATT
JMSF032B11- TGTGAAACCGACGACGATTGCAAGAATTGTCCAGCAGCAGCTAGTTGCGAGAAATATATT
                      ____________________________________________________________
consensus TGTGAAACCGACGACGATTGCAAGAATTGTCCAGCAGCAGCTAGTTGCGAGAAATATATT
 
. : . : . : . : . : . :
rJMSF032B11+ ATGAACGGCACTTGTGTGTGATCTTGTTCTGCTCGATATTAAAGATTTGCTACGTTCAAC
JMSF032B11- ATGAACGGCACTTGTGTGTGATCTTGTTCTGCTCGATATTAAAGATTTGCTACGTTCAAC
                      ____________________________________________________________
consensus ATGAACGGCACTTGTGTGTGATCTTGTTCTGCTCGATATTAAAGATTTGCTACGTTCAAC
 
. : . : . : . : . : . :
rJMSF032B11+ TTTATG
JMSF032B11- TTTATGTGTAACTATCTCTTATGTTTAATCGCATTAAAGATTTGCTACGTTCAAAANANA
                      ____________________________________________________________
consensus TTTATGTGTAACTATCTCTTATGTTTAATCGCATTAAAGATTTGCTACGTTCAAAANANA