Previous Contig 006788:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H05Sequence496006788 (21)gb:PTR306829_17027231e-19Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).682006788 (21)gb:AF373100_17926961e-73Populus tremula x Populus tremuloides auxin-regulated protein (IAA1) mRNA, compl
JMFF011B05Sequence535006788 (21)gb:AY087765_15727921e-28Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMFF020P07Sequence482006788 (21)gb:AY087765_15727921e-18Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMFF024N23Sequence412001186 (2)gb:PTR306829_17027231e-16Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).705006788 (21)gb:AY087765_15727921e-68Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMFF027E17Sequence481006788 (21)gb:AY087765_15727921e-19Arabidopsis thaliana clone 38286 mRNA, complete sequence.702006788 (21)gb:PTR306829_17027232e-50Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).
JMFF028A07Sequence407006788 (21)gb:AY087765_15727921e-07Arabidopsis thaliana clone 38286 mRNA, complete sequence.717006788 (21)gb:PTR306829_17027232e-63Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).
JMFF030N20Sequence323006788 (21)gb:AY087765_15727924e-08Arabidopsis thaliana clone 38286 mRNA, complete sequence.726006788 (21)gb:AY087765_15727922e-59Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMSF013B15Sequence348006788 (21)gb:AY087765_15727920.002Arabidopsis thaliana clone 38286 mRNA, complete sequence.764006788 (21)gb:PTR306829_17027234e-58Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).
JMSF017J02Sequence466006788 (21)gb:AY087765_15727929e-19Arabidopsis thaliana clone 38286 mRNA, complete sequence.776006788 (21)gb:PTR306829_17027233e-57Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).
JMSF017K02Sequence481006788 (21)gb:AY087765_15727927e-19Arabidopsis thaliana clone 38286 mRNA, complete sequence.707006788 (21)gb:PTR306829_17027233e-58Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).
JMSF026B10Sequence711006788 (21)gb:AY087765_15727921e-45Arabidopsis thaliana clone 38286 mRNA, complete sequence.737006788 (21)gb:AY087765_15727923e-67Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMSF032B04Sequence713006788 (21)gb:AY087765_15727924e-45Arabidopsis thaliana clone 38286 mRNA, complete sequence.727006788 (21)gb:AY087765_15727922e-64Arabidopsis thaliana clone 38286 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027E17- GTGTTGGGATTTCATGAA
                      ____________________________________________________________
consensus GTGTTGGGATTTCATGAA
 
. : . : . : . : . : . :
rJMFF027E17- AGAATAAAACACACAACCACTATGACAGCAAAGACAAGTACAACAACAACAATAATACAA
rJMSF013B15- CAACAACAACAATAATACAA
rJMSF017K02- AATAATACAA
rJMSF017J02- ACAACAACAATAATACAA
                      ____________________________________________________________
consensus AGAATAAAACACACAACCACTATGACAGCAAAGACAAGTACAACAACAACAATAATACAA
 
. : . : . : . : . : . :
rJMFF027E17- AGGAAAAAAATAAAAACAAAAAACTATAAGCTGCAACAAGCCATGAATTAGTAATTAAAC
rJMSF013B15- AGGAAAAAAATAAAAACAAAAAACTATAAGCTGCAACAAGCCATGAATTAGTAATTAAAC
rJMSF017K02- AGGAAAAAAATAAAAACAAAAAACTATAAGCTGCAACAAGCCATGAATTAGTAATTAAAC
rJMSF017J02- AGGAAAAAAATAAANACAAAAAACTATAAGCTGCAACAAGCCATGAATTAGTAATTAAAC
                      ____________________________________________________________
consensus AGGAAAAAAATAAAAACAAAAAACTATAAGCTGCAACAAGCCATGAATTAGTAATTAAAC
 
. : . : . : . : . : . :
rJMFF027E17- AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
rJMSF013B15- AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
rJMSF017K02- AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
rJMSF017J02- AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
rJMFF028A07- AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
rJMSF032B04- AGGTTTTTGCTTCNTGTCCATTACAAATAATGTCCNAAAG
rJMFF030N20- GGTTTTTGCTTCTTGTCCACTACAAATAATGTCCAAAAG
rJMSF026B10- ATGTCCAAAAG
                      ____________________________________________________________
consensus AAGCCAGACAATAGGGTTTAAGGTTTTTGCTTCTTGTCCATTACAAATAATGTCCAAAAG
 
. : . : . : . : . : . :
rJMFF027E17- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMSF013B15- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMSF017K02- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMSF017J02- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMFF028A07- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMSF032B04- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMFF030N20- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
rJMSF026B10- ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
                      ____________________________________________________________
consensus ATGTTTTATAAGTATCAGTATACTATGAATCATCATCAAATAAAAACTTACAGACACAAT
 
. : . : . : . : . : . :
rJMFF027E17- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
rJMSF013B15- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
rJMSF017K02- ACTCAGATCATCATCATCATCAAAAAATTATAACATCATGCATATATGAATTGAACCCCT
rJMSF017J02- ACTCAGATCATCATCATCATCAAAAAATTATAACATCATGCATATATGAATTGAACCCCT
rJMFF028A07- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
rJMSF032B04- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
rJMFF030N20- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
rJMSF026B10- ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
                      ____________________________________________________________
consensus ACTCAGATCATCATCATCATCAAACAATTATAACATCATGCATATATGAATTGAACCCCT
 
. : . : . : . : . : . :
rJMFF027E17- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMSF013B15- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMSF017K02- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMSF017J02- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMFF028A07- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMSF032B04- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMFF030N20- TAGCTTCTTCTTCTCCTTCCATTTTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMSF026B10- TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
rJMFF010H05- GATATGTAGAAGTATGCCTTA
                      ____________________________________________________________
consensus TAGCTTCTTCTTCTCCTTCCATTCTTTCATGCACAACTTGATATGTAGAAGTATGCCTTA
 
. : . : . : . : . : . :
rJMFF027E17- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMFF024N23- TCTTGCATTTCTCCATGACTCTTGGGGCAAGTCCAATAGCTTC
rJMSF013B15- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMSF017K02- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMSF017J02- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMFF028A07- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMSF032B04- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMFF030N20- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMSF026B10- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
rJMFF010H05- AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
                      ____________________________________________________________
consensus AGCTTATTAGCATCTGTTCTTGCATTTCTCCACAGCTCTTGGTGCAAGTCCAATTGCTTC
 
. : . : . : . : . : . :
rJMFF027E17- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMFF024N23- TGACCCTTTGATTATGCGTAGGCGCTTGCAAGAATCAACAAACATCTCCCATGGTACATC
rJMSF013B15- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMSF017K02- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMSF017J02- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMFF028A07- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMSF032B04- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMFF030N20- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMSF026B10- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
rJMFF010H05- TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
                      ____________________________________________________________
consensus TGATCCTTTCATTATGCGTAGGCGTTTGCATGAATCAACAAACATCTCCCAGGGTACATC
 
. : . : . : . : . : . :
rJMFF027E17- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMFF024N23- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCGTACGTCGGCACATATTCAGAGCTGTT
rJMSF013B15- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMSF017K02- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMSF017J02- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMFF028A07- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMSF032B04- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMFF030N20- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMSF026B10- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
rJMFF010H05- CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
                      ____________________________________________________________
consensus CCCCACGAGCATCCAGTCTCCATCCTTATCTTCATAGGTGGGCACATATTCTGAGCTGTT
 
. : . : . : . : . : . :
rJMFF027E17- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMFF024N23- GAGTAGATCCATCAGTTTCCTCTCATTCATGAAATCTATCATTCCCTGGGCCCCATAATT
rJMSF013B15- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMSF017K02- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMSF017J02- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMFF028A07- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMSF032B04- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMFF030N20- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMSF026B10- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
rJMFF010H05- TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
JMSF026B10+ GAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
JMSF032B04+ AGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
                      ____________________________________________________________
consensus TAGGAGATCCATCAGCTTCCTCTCATTCATGAAATCTATCATGCCTTGGGCCCCATAATT
 
. : . : . : . : . : . :
rJMFF027E17- AC------CCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMFF024N23- GCCAG------TAGTGAAGGAACTGAACATGTTGGCCAAAGCATCAGAGAGTTGATTGTA
rJMSF013B15- AC------CCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMSF017K02- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTG
rJMSF017J02- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTG
rJMFF028A07- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMSF032B04- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMFF030N20- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMSF026B10- ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
rJMFF010H05- AC------CCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
JMFF011B05+ GGCAAGAGCATCAGAAAGTTGTTGGTA
JMSF026B10+ ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
JMSF032B04+ ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
                      ____________________________________________________________
consensus ACCTGCATCCATGGTGAAGGAGCTGAACATCTTGGCAAGAGCATCAGAAAGTTGTTGGTA
 
. : . : . : . : . : . :
rJMFF027E17- GCTTTCATACATCTTCAAGTCCACCTTACG
rJMFF024N23- GGTGTTATACACCTTCAAGTCCACCTTGCGCAGGTAAGGTGCACCATCCATGCTCACCTT
rJMSF013B15- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMSF017K02- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMSF017J02- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMFF028A07- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMSF032B04- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMFF030N20- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMSF026B10- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
rJMFF010H05- GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACANCTT
JMFF011B05+ GNTTTCATACATNTTCAAGTCCACCTTANGAAGGTAGGGTGCACCGTCCATGCACACNTT
JMSF026B10+ GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
JMSF032B04+ GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
                      ____________________________________________________________
consensus GCTTTCATACATCTTCAAGTCCACCTTACGAAGGTAGGGTGCACCGTCCATGCACACCTT
 
. : . : . : . : . : . :
rJMFF024N23- CACAAA
rJMSF013B15- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
rJMSF017K02- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCT
rJMSF017J02- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCNGGCGGCCTCCTCCGGGCTGCT
rJMFF028A07- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
rJMSF032B04- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
rJMFF030N20- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
rJMSF026B10- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
rJMFF010H05- CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
JMFF011B05+ CACAAACGCTGCCGGCCCTCCACCGCCGCTNTTCTNTCCGGCGGCCTCCTCCGGGCTGCT
JMFF027E17+ CTCCGGGCTGCT
JMSF026B10+ CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
JMSF017K02+ TCCGGGCTGCT
JMFF020P07+ CCTCCGGGCTGCC
JMFF010H05+ TCCGGCGGCCTCCTCCGGGCTGCT
JMSF032B04+ CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
                      ____________________________________________________________
consensus CACAAACGCTGCCGGCCCTCCACCGCCGCTCTTCTCTCCGGCGGCCTCCTCCGGGCTGCT
 
. : . : . : . : . : . :
rJMSF013B15- CTTCTGAGCCATTATGTTCTT-C
rJMSF017J02- CTTCTGAGCCATTATGTTCTT-CCGGTA
rJMFF028A07- CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-G
rJMSF032B04- CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGGCATCCCACCACCT-GA
rJMFF030N20- CTTCTGAGCCATTATGTTCTTCCCGGTAATTCCTCACCGGCGGCCATCCCACCACCTGGA
rJMSF026B10- CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
rJMFF010H05- CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMFF011B05+ CTTNTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMFF027E17+ CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMSF026B10+ CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMSF017K02+ CTTNTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMFF020P07+ CTTNTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMSF017J02+ TGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMFF010H05+ CTTNTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
JMSF032B04+ CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
                      ____________________________________________________________
consensus CTTCTGAGCCATTATGTTCTT-CCGGTAATTCCTCACCGGCGGCCATCCCACCACCT-GA
 
. : . : . : . : . : . :
rJMSF032B04- GCCTTGGATGGGGGCTNGATGGGATCC
rJMFF030N20- GCCTTGGATGGGGGCTTGATGGGATCC
rJMSF026B10- GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
rJMFF010H05- GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF011B05+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF027E17+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMSF026B10+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMSF017K02+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF020P07+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMSF017J02+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF028A07+ TGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF030N20+ CTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMFF010H05+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
JMSF032B04+ GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
                      ____________________________________________________________
consensus GCCTTGGATGGGGGCTTGATGGGATCCTTGTTAGGTTCCTTTGAAGGAGACTTCATCTTC
 
. : . : . : . : . : . :
rJMSF026B10- TCCTTGAG
rJMFF010H05- TCCTTGAGATCCAGAAGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTNAACGGT
JMFF011B05+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMFF027E17+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMSF026B10+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMSF017K02+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMFF020P07+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMSF017J02+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMFF028A07+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMSF013B15+ AGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMFF030N20+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMFF010H05+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
JMSF032B04+ TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
                      ____________________________________________________________
consensus TCCTTGAGATCCAG-AGAGGAGTCGGCGGCGGACTGAAGGTTGAGCTTGAGGTCAACGGT
 
. : . : . : . : . : . :
rJMFF010H05- CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF011B05+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF027E17+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMSF026B10+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMSF017K02+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF020P07+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMSF017J02+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF028A07+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMSF013B15+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF030N20+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMFF010H05+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
JMSF032B04+ CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
                      ____________________________________________________________
consensus CTCGGAAAATCCTCGTTTTCCGGTGACCTTCAACGACTCACTTTCATTTCCGCCGCCGCC
 
. : . : . : . : . : . :
rJMFF010H05- GCCG
JMFF011B05+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMFF027E17+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMSF026B10+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMSF017K02+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMFF020P07+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMSF017J02+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMFF028A07+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMSF013B15+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMFF030N20+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMFF010H05+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
JMSF032B04+ GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
                      ____________________________________________________________
consensus GCCGGGGAGGCCAAGGCAGAGCTCAGTGGCTTTCAGATTCAGGCCTCCGTGCTCAGCCAA
 
. : . : . : . : . : . :
JMFF011B05+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMFF027E17+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMSF026B10+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMSF017K02+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMFF020P07+ CATGCTTCCAATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMSF017J02+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMFF028A07+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMSF013B15+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMFF030N20+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMFF010H05+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
JMSF032B04+ CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
                      ____________________________________________________________
consensus CATGCTTCCCATTTTCCGGCCAACTTCCATGGAATCCGATGACGATTACGATCTATTCTC
 
. : . : . : . : . : . :
JMFF011B05+ TTCTCCACACTCTCCACCTTCTCTTTC
JMFF027E17+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMSF026B10+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMSF017K02+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMFF020P07+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMSF017J02+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMFF028A07+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMSF013B15+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMFF030N20+ TTCTCCACACTCTCCACCTTCTCTTT
JMFF010H05+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
JMSF032B04+ TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
                      ____________________________________________________________
consensus TTCTCCACACTCTCCACCTTCTCTTTCTTCTCTTCTTGATCGATCAAATATTAATTAATA
 
. : . : . : . : . : . :
JMFF027E17+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAAT
JMSF026B10+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAATA
JMSF017K02+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAA
JMFF020P07+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAAT
JMSF017J02+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAA
JMFF028A07+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAAT
JMSF013B15+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAATA
JMFF010H05+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAATA
JMSF032B04+ GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAATAGGAGATC
                      ____________________________________________________________
consensus GCGATACGATGGGCGACACGAGAAAATATTGACAGTGCAATGATATAGCAATAGGAGATC