Previous Contig 006785:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G04Sequence525006785 (33)pir|T10174|T101746e-47hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown712006785 (33)pir|T10174|T101743e-54hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF012B19Sequence446006785 (33)pir|T10174|T101748e-33hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown637006785 (33)pir|T10174|T101741e-45hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF013H08Sequence519006785 (33)gb:BT000660_16349381e-46Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR639006785 (33)pir|T10174|T101742e-45hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF013P01Sequence533006785 (33)pir|T48501|T485013e-74hypothetical protein F15N18.10 - Arabidopsis thaliana>gb:ATF15N18_1548729 Arabid690006785 (33)pir|T10174|T101744e-55hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF015I06Sequence569006785 (33)gb:BT000660_16349382e-53Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR320006785 (33)gb:BT008446_16396637e-04Arabidopsis thaliana At5g25460 gene, complete cds.>gb:AF386962_1794767 Arabidops
JMFF029C04Sequence512006785 (33)gb:BT000660_16349385e-43Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR705006785 (33)pir|T10174|T101746e-56hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF036D12Sequence542006785 (33)gb:BT000660_16349382e-42Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR710006785 (33)pir|T10174|T101748e-73hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF036K04Sequence525006785 (33)gb:BT000660_16349383e-47Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR663006785 (33)pir|T10174|T101744e-55hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF037A10Sequence524006785 (33)gb:BT000660_16349381e-41Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR666006785 (33)pir|T10174|T101742e-53hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF037H12Sequence567006785 (33)gb:BT000660_16349385e-47Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR
JMFF037J18Sequence571006785 (33)gb:BT000660_16349388e-47Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR694006785 (33)pir|T10174|T101742e-75hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF041G22Sequence643006785 (33)gb:BT000660_16349382e-67Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR606006785 (33)pir|T10174|T101743e-46hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF042P12Sequence647006785 (33)gb:BT000660_16349385e-67Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR
JMFF043N20Sequence634006785 (33)pir|T10174|T101749e-66hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown552006785 (33)pir|T10174|T101746e-32hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFS006C10Sequence548006785 (33)gb:BT000660_16349382e-53Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR
JMFS056B05Sequence618006785 (33)gb:BT000660_16349383e-63Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR
JMFS158E04Sequence410006785 (33)pir|T10174|T101742e-39hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMSF032A24Sequence671006785 (33)gb:BT000660_16349387e-70Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR690006785 (33)pir|T10174|T101741e-49hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMSF045J14Sequence769006785 (33)gb:BT000660_16349381e-86Arabidopsis thaliana clone RAFL07-10-E04 (R10867) unknown protein (At5g11420) mR771006785 (33)pir|T10174|T101741e-82hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032A24- ATTTTCTGCATTATTGTGTTGGATTACATAATAAAGCACTGAGCAAC
rJMFF013H08- TAATAAAGCACTGAGCAAC
rJMFF043N20- ACTGAGCAAC
rJMFF006G04- TTATTGTGTTGGATTACATAATAAAGCACTGAGCAAC
                      ____________________________________________________________
consensus ATTTTCTGCATTATTGTGTTGGATTACATAATAAAGCACTGAGCAAC
 
. : . : . : . : . : . :
rJMSF032A24- AAACACAATATACATATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF013H08- AAACACAATATACATATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF041G22- ACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF043N20- AAACACAATATACATATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF015I06- TATATTATATATATG
rJMFF006G04- AAACACAATATACATATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF012B19- ATATATCTTTTC-ACTTTC-ATAGCTTAATTATATTATATATA-G
rJMFF037A10- ATATACATATATATCTTTTC-ACTTTC-ATAGCTTAATTATATTATATATA-G
rJMFF036K04- TATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
rJMFF013P01- TTATATATA-G
                      ____________________________________________________________
consensus AAACACAATATACATATATATCTTTTCAACTTTCAATAGCTTAATTATATTATATATA-G
 
. : . : . : . : . : . :
rJMSF032A24- AGAGATCATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF013H08- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF041G22- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF043N20- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF015I06- AGAGATTATCAAGAGTATGCAATGTNNCATGNATGCTTANGCTTANCTNCTTGAANGTAC
rJMFF006G04- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF012B19- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF037A10- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF036K04- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF013P01- AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
rJMFF029C04- GGCTTAGCTTCTTGAAGGTAC
rJMFF036D12- GCTTAGCTTCTTGAAGGTAC
rJMFF037J18- AGGTAC
                      ____________________________________________________________
consensus AGAGATTATCAA-AGTATGCAATGTAACATGCATGCTTAGGCTTAGCTTCTTGAAGGTAC
 
. : . : . : . : . : . :
rJMSF032A24- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF013H08- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF041G22- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF043N20- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
JMFS158E04- TATAAT
rJMFF015I06- ATATATATAATTCTCCTCGTCNTCACTTCATACTACCANCAAAAATCTCCTTATNATAAT
rJMFF006G04- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF012B19- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF037A10- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF036K04- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF013P01- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF029C04- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF036D12- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMFF037J18- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
rJMSF045J14- ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
                      ____________________________________________________________
consensus ATATATATAATTCTCCTCGTCATCACTTCATACTACCAACAAAAATCTCCTTAGTATAAT
 
. : . : . : . : . : . :
rJMSF032A24- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF013H08- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF041G22- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF043N20- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
JMFS158E04- CAAACAATCATACAACAACCTCGGACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF015I06- CAAACAATCATACAACAACCTCGTACGCNCTTAACTTGATGCCNCCACCGCCGCCGTCTA
rJMFF006G04- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF012B19- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF037A10- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF036K04- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF013P01- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF029C04- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF036D12- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMFF037J18- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
rJMSF045J14- CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
                      ____________________________________________________________
consensus CAAACAATCATACAACAACCTCGTACGCACTTAACTTGATGCCGCCACCGCCGCCGTCTA
 
. : . : . : . : . : . :
rJMSF032A24- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF013H08- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF041G22- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF043N20- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
JMFS158E04- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF015I06- ATTTCANGCNANTCTCCGNTGANGGTTGCNAACGCTGANNAGCTTCACAAANTCGACNAC
rJMFF006G04- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF012B19- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF037A10- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF036K04- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF013P01- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF029C04- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF036D12- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMFF037J18- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
rJMSF045J14- ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
                      ____________________________________________________________
consensus ATTTCAGGCGAGTCTCCGGTGAGGGTTGCGAACGCTGACGAGCTTCACGAAGTCGACGAC
 
. : . : . : . : . : . :
rJMSF032A24- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF013H08- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF041G22- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF043N20- GGGGCCACTGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
JMFS158E04- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF015I06- GGGGCCACAGAGCNAGACAAAATCATCNCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF006G04- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF012B19- GGGGCCACTGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF037A10- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF036K04- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF013P01- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF029C04- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF036D12- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMFF037J18- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
rJMSF045J14- GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
                      ____________________________________________________________
consensus GGGGCCACAGAGCGAGACGAAATCGTCGCTCCTGGTGTGATAATACGTGCTGAAGAACAT
 
. : . : . : . : . : . :
rJMSF032A24- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF013H08- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF041G22- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF043N20- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
JMFS158E04- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF015I06- GAC
rJMFF006G04- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF012B19- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF037A10- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF036K04- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF013P01- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTCGGCCGGTTTATAGCCGCCTTG
rJMFF029C04- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF036D12- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMFF037J18- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
rJMSF045J14- GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
JMFF013P01+ GTGGCCCTGAACCGGAGCTCGGCCGGTTTATAGCCGCCTTG
                      ____________________________________________________________
consensus GACCCGGGTCCGGTTCGCGGTGGCCCTGAACCGGAGCTTGGCCGGTTTATAGCCGCCTTG
 
. : . : . : . : . : . :
rJMSF032A24- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF013H08- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF041G22- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF043N20- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
JMFS158E04- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF006G04- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF012B19- GCCCTTGGACTCGTAGGGGACCTTGAGGGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF037A10- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF036K04- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF013P01- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF029C04- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF036D12- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMFF037J18- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
rJMSF045J14- GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
JMFF013P01+ GCCCTTGGACTNGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
                      ____________________________________________________________
consensus GCCCTTGGACTCGTAGGGGACCTTGA-GGGTGGAGGGTCCGGCGAAGGCCTCGAGCACCA
 
. : . : . : . : . : . :
rJMSF032A24- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF013H08- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF041G22- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF043N20- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAAAACTTGC
JMFS158E04- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF006G04- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF012B19- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF037A10- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCNTAGAACTTGC
rJMFF036K04- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF013P01- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF029C04- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF036D12- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMFF037J18- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
rJMSF045J14- TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
JMFF013P01+ TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
                      ____________________________________________________________
consensus TAGACCCCTCGCACTTGTTGCTGGCGTCGCCGACTAGGAAGGTGAGGTCGTAGAACTTGC
 
. : . : . : . : . : . :
rJMSF032A24- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF013H08- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF041G22- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF043N20- CGGCG
JMFS158E04- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGG
rJMFF006G04- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF012B19- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF037A10- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF036K04- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF013P01- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF029C04- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF036D12- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMFF037J18- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
rJMSF045J14- CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
JMFF013P01+ CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
                      ____________________________________________________________
consensus CGGCGACGGTGCGGGCGATCTGGGTGACGGCGCTCTCTTTCCCGGCCACCAGCTCCACCG
 
. : . : . : . : . : . :
rJMSF032A24- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTT
rJMFF013H08- CCCTCCGGCCGTGGGGCACGCTG
rJMFF041G22- CCCTCCGGCCGTGGGGCACGCTNGAGTGCTCCGCG
rJMFF006G04- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF012B19- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTC
rJMFF037A10- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF036K04- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF013P01- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF029C04- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF036D12- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMFF037J18- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
rJMSF045J14- CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
JMFF013P01+ CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
                      ____________________________________________________________
consensus CCCTCCGGCCGTGGGGCACGCTGAAGTGCTCCGCGTCTATGTACTTCACGGCTTTCAGAG
 
. : . : . : . : . : . :
rJMFF006G04- ACTCCACCGTCCA
rJMFF037A10- ACTCCACCGTCCAGGCCG
rJMFF036K04- ACTCCACCGTCCAGGCCGGA
rJMFF013P01- ACTCCACCGTCCAGGCCGGAANNCGGGGAAGTGGTCGTCCTCCGTGAACGGGCGGGCAAA
rJMFF029C04- ACTCCACCGTCCAGGCCGGAAGCCGGGGAAGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
rJMFF036D12- ACTCCACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
rJMFF037J18- ACTCCACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
rJMSF045J14- ACTCCACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
JMFF013P01+ ACTCCACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
JMSF045J14+ CACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
                      ____________________________________________________________
consensus ACTCCACCGTCCAGGCCGGAAGCGGGG--AGTGGTCGTCCTCCGTGAAC-GGCGGGC-AA
 
. : . : . : . : . : . :
rJMFF013P01- AAAACGCCGGTGTCTANCTTGG
rJMFF029C04- AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
rJMFF036D12- AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
rJMFF037J18- AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
rJMSF045J14- AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
JMFF013P01+ AGAACGCCGGTGTCTAGCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
JMSF045J14+ AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
JMSF032A24+ AATCCCAATTTTTT
                      ____________________________________________________________
consensus AGAACGCCGGTGTCTACCTTGGGGAACACGTATGGGCCCTCCTCAAAATCCCAATTTTTT
 
. : . : . : . : . : . :
rJMFF029C04- AACAAGTTCACGTTGGTANGTCTGGGA
rJMFF036D12- AACAAGTTCACGTTGGTANGTCTGGGA
rJMFF037J18- AACAAGTTCACGTTGGTAGGTCTGGGAGGATAC
rJMSF045J14- AACAAGTTCACGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
JMFF013P01+ AACAAGTTCACGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
JMSF045J14+ AACAAGTTCACGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
JMFS056B05+ GATACAATGTTCGGATGGCGACGGAATCGATG
JMFF041G22+ CGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
JMFF042P12+ CGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGNCGACGGAATCGATG
JMFF043N20+ GGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
JMSF032A24+ AACAAGTTCACGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
                      ____________________________________________________________
consensus AACAAGTTCACGTTGGTAGGTCTGGGAGGATACAATGTTCGGATGGCGACGGAATCGATG
 
. : . : . : . : . : . :
rJMSF045J14- AGCGGACCGCAAGNCCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCG
JMFF013P01+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMSF045J14+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFS056B05+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFS006C10+ TCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF041G22+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF042P12+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF043N20+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF015I06+ ACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF037H12+ CCGGGGTTATGAATTATGATCTCCGCTTG
JMFF037J18+ CACGCCGGGGTTATGAATTATGATCTCCGCTTG
JMFF036D12+ CTTG
JMSF032A24+ AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
                      ____________________________________________________________
consensus AGCGGACCGCAAG-CCGGGTCCTCCTCCACGCCGGGGTTATGAATTATGATCTCCGCTTG
 
. : . : . : . : . : . :
JMFF013P01+ GGGATTCTCAGCCTGGAA
JMSF045J14+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFS056B05+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFS006C10+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF041G22+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF042P12+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF043N20+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF036K04+ CTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF013H08+ GGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF029C04+ GCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF015I06+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF037H12+ GGGATTCTCAGCCTGGAACGCCCACGNGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF037J18+ GGGATTCTCAGCCTGGAACGCCCACGGGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF036D12+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF006G04+ CTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMFF037A10+ GGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
JMSF032A24+ GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
                      ____________________________________________________________
consensus GGGATTCTCAGCCTGGAACGCCCACGCGTAGCAATCCCAGCCGTTGATACTGTACAGCGT
 
. : . : . : . : . : . :
JMSF045J14+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFS056B05+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFS006C10+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF041G22+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF042P12+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF043N20+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF036K04+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF013H08+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF029C04+ TTGGATGGGCAGCACGTCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF015I06+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF037H12+ TTGGATGGGCAGCACGCCGGAGTCCCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF037J18+ TTGGATGGGCAGCACGTCGGAGTCCCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF036D12+ TTGGATGGGCAGCACGTCGGAGTCCCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF012B19+ ACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF006G04+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGTCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMFF037A10+ TTGGATGGGCAGCACGCCGGAGTCCCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
JMSF032A24+ TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
                      ____________________________________________________________
consensus TTGGATGGGCAGCACGCCGGAGT-CCGGCGCCACCGTGATGTTGAGCCGCTCCTCCTGGG
 
. : . : . : . : . : . :
JMSF045J14+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFS056B05+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFS006C10+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF041G22+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF042P12+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF043N20+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF036K04+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF013H08+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF029C04+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF015I06+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF037H12+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF037J18+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF036D12+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF012B19+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF006G04+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMFF037A10+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
JMSF032A24+ CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
                      ____________________________________________________________
consensus CGCAGGTCCGGGCGGCGCAGAACGTGATGGAGTAGTACATCCCTTTGGAGACGTTGAGCG
 
. : . : . : . : . : . :
JMSF045J14+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFS056B05+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFS006C10+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF041G22+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF042P12+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF043N20+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF036K04+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF013H08+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF029C04+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF015I06+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF037H12+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF037J18+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF036D12+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF012B19+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF006G04+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMFF037A10+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
JMSF032A24+ TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
                      ____________________________________________________________
consensus TTTGCTTGATGGACGCCTCGTTGCCCAGCCGCACGGCGGCGAACCCCTCCGGCACCACCA
 
. : . : . : . : . : . :
JMSF045J14+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFS056B05+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFS006C10+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF041G22+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF042P12+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF043N20+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF036K04+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF013H08+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF029C04+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF015I06+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF037H12+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF037J18+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF036D12+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF012B19+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF006G04+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMFF037A10+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
JMSF032A24+ GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
                      ____________________________________________________________
consensus GTTGCATGTCGCCTTGCTTCTGCCCCGCCTGTATGTACTCCACGAACCCCGTCACGGTCC
 
. : . : . : . : . : . :
JMSF045J14+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFS056B05+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFS006C10+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF041G22+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF042P12+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF043N20+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF036K04+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF013H08+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF029C04+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF015I06+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF037H12+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF037J18+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF036D12+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF012B19+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF006G04+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMFF037A10+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
JMSF032A24+ ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
                      ____________________________________________________________
consensus ATCCCGGAACGGCGTCGTGCCGGGTCACGATTGTGCCGTTTAGGTCCGTTTTCTTCACCG
 
. : . : . : . : . : . :
JMSF045J14+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFS056B05+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFS006C10+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF041G22+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF042P12+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF043N20+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGACGG
JMFF036K04+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF013H08+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF029C04+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF015I06+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF037H12+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF037J18+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF036D12+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF012B19+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF006G04+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMFF037A10+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
JMSF032A24+ GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
                      ____________________________________________________________
consensus GAGCTTCGAAGTTCCCGTTCACTAGTAGTCCGTCGGTGAGGGCGGAGGAGATTTGGAC-G
 
. : . : . : . : . : . :
JMSF045J14+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFS056B05+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFS006C10+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF041G22+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF042P12+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF043N20+ GTGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF036K04+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF013H08+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF029C04+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF015I06+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF037H12+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF037J18+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF036D12+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF012B19+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF006G04+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMFF037A10+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
JMSF032A24+ GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
                      ____________________________________________________________
consensus GCGGCGGAGAGCAGCACCGCCAGTAAAAGAACCGCTTGCGCTTTTGAAGTAGTCTGCATT
 
. : . : . : . : . : . :
JMSF045J14+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFS056B05+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAG
JMFS006C10+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGA
JMFF041G22+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATT
JMFF042P12+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTC
JMFF043N20+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFF036K04+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFF013H08+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGAT
JMFF029C04+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGGTTCGT
JMFF015I06+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFF037H12+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATT
JMFF037J18+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGGTTCGT
JMFF036D12+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGGTTCGT
JMFF012B19+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFF006G04+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMFF037A10+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGT
JMSF032A24+ TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGTT
                      ____________________________________________________________
consensus TTGTTTTGGGTTTTGAAAAGTGAAGAAAGAGAGGAGAGAGTCTGAAAAGGGGGATTCGTT