Previous Contig 006772:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015O09Sequence342006772 (2)780022678gb:AP004045_18368292e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF031O14Sequence638006772 (2)704023503gb:AF485893_18041005e-21Dendrobium sp. XMW-2002-2 MYB2 (MYB2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031O14+ CTCTCTCCCTCAAAACCATAAGCAATGATATATGAAGC
                      ____________________________________________________________
consensus CTCTCTCCCTCAAAACCATAAGCAATGATATATGAAGC
 
. : . : . : . : . : . :
JMSF031O14+ CAAACCTTGCATTAATTTNGGCAGGGCTAGCTTTGTCAATGCAAGTTCCACTTCTTTAGT
                      ____________________________________________________________
consensus CAAACCTTGCATTAATTTNGGCAGGGCTAGCTTTGTCAATGCAAGTTCCACTTCTTTAGT
 
. : . : . : . : . : . :
JMSF031O14+ AACCTCTACATAGAAAATAATACACATTGAAATTAAAGGACACTAAAGGTATTGTTTTTC
                      ____________________________________________________________
consensus AACCTCTACATAGAAAATAATACACATTGAAATTAAAGGACACTAAAGGTATTGTTTTTC
 
. : . : . : . : . : . :
JMSF031O14+ TTAAGATACATGTAACAATAATGCTTTAAAAATCTGTAGTATTCTTTAAAAATATAACTT
                      ____________________________________________________________
consensus TTAAGATACATGTAACAATAATGCTTTAAAAATCTGTAGTATTCTTTAAAAATATAACTT
 
. : . : . : . : . : . :
JMSF031O14+ TGCAGTAGTAGTCATGTTTGCAGCAGTATTCTATAAAATTCTAAAAATATAATGCTTTTT
                      ____________________________________________________________
consensus TGCAGTAGTAGTCATGTTTGCAGCAGTATTCTATAAAATTCTAAAAATATAATGCTTTTT
 
. : . : . : . : . : . :
JMSF031O14+ AATATAAAAAATGCTCAGCCACCGCCAACATGGTTATGCTCTTCTCATTAAAATTTTTAA
                      ____________________________________________________________
consensus AATATAAAAAATGCTCAGCCACCGCCAACATGGTTATGCTCTTCTCATTAAAATTTTTAA
 
. : . : . : . : . : . :
JMSF031O14+ TCGTTGTTGTTCAATGCGCTACATACTATCGTATTATCTATATTTTGTTATTAACTATTT
                      ____________________________________________________________
consensus TCGTTGTTGTTCAATGCGCTACATACTATCGTATTATCTATATTTTGTTATTAACTATTT
 
. : . : . : . : . : . :
JMSF031O14+ GCGCTTTGTATTCTTAGATATCTACCAGCAGAACTGCTTTAGTGGATTTAAAATCAAAAT
                      ____________________________________________________________
consensus GCGCTTTGTATTCTTAGATATCTACCAGCAGAACTGCTTTAGTGGATTTAAAATCAAAAT
 
. : . : . : . : . : . :
JMSF015O09+ AAAAACAAAACCTGGTTCGGCTTGTACTTCTCGTTTCG
JMSF031O14+ CTCGGCCATATCTTCACAGATTAAAAACAAAACCTGGTTCGGCTTGTACTTCTCCTTTCC
                      ____________________________________________________________
consensus CTCGGCCATATCTTCACAGATTAAAAACAAAACCTGGTTCGGCTTGTACTTCTCGTTTCG
 
. : . : . : . : . : . :
JMSF015O09+ GTAGTTGGCAGAGACC-AAATTCTTCCGATTGTC-AATATCATATGGTTCAGCTTGTGCT
JMSF031O14+ GTAGTCGGCAGAGACCAAAATTCTTCCGGTTGTCGGATATCGAATGGCTCGGCTTGTGCT
                      ____________________________________________________________
consensus GTAGTTGGCAGAGACCAAAATTCTTCCGGTTGTCGGATATCGTATGGTTCGGCTTGTGCT
 
. : . : . : . : . : . :
JMSF015O09+ TCTCCCATCGGTAGTCGGCA
JMSF031O14+ TCTCCTTTGGGTAGTCGGCAGAGAGAATTGTGCTTCTCGCTTCTACTTTTGCTGCCCTCA
                      ____________________________________________________________
consensus TCTCCTTTGGGTAGTCGGCAGAGAGAATTGTGCTTCTCGCTTCTACTTTTGCTGCCCTCA