Previous Contig 006765:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005I13Sequence368014138pir|D96689|D966890.006calmodulin-related protein, 72976-72503 [imported] - Arabidopsis thaliana>gb:AE0334006765 (9)pir|D96689|D966890.006calmodulin-related protein, 72976-72503 [imported] - Arabidopsis thaliana>gb:AE0
JMFF033P15Sequence546006765 (9)gb:AY088814_15738243e-36Arabidopsis thaliana clone 95959 mRNA, complete sequence.685006765 (9)gb:AC120985_17399803e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s
JMFN009D19Sequence622006765 (9)gb:AC120985_17399803e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s
JMFN017D12Sequence610006765 (9)gb:AC120985_17399802e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s
JMFN031E23Sequence622006765 (9)gb:AC120985_17399803e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s
JMFN031K13Sequence639006765 (9)gb:AC120985_17399803e-41Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s
JMSF031N02Sequence665006765 (9)gb:AC120985_17399801e-39Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s652006765 (9)gb:AC120985_17399809e-40Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033P15- ATTCATGAAATTGGACTT
                      ____________________________________________________________
consensus ATTCATGAAATTGGACTT
 
. : . : . : . : . : . :
rJMFF005I13- CAGCTT
rJMFF033P15- GGATCGGAATAACCGTAGAAATATTTGGAATAAATCGTAATCCAGTCATATCAACAGCTT
rJMSF031N02- GCTT
JMSF031N02+ CAGCTT
                      ____________________________________________________________
consensus GGATCGGAATAACCGTAGAAATATTTGGAATAAATCGTAATCCAGTCATATCAACAGCTT
 
. : . : . : . : . : . :
rJMFF005I13- TTGGCCGAAAAAAAAAAGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
rJMFF033P15- TTGGCCGAAAAAAAAAAGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
JMFN031E23+ GTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
JMFN017D12+ AGTAATACAGCCATGCAATAAGCATCTA
JMFN031K13+ AAAAAAAAAAGTATGAAGTTNGGACAGTAATACAGCCATGCAATAAGCATCTA
rJMSF031N02- TTGGCCGAAAAAAAAAAGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
JMFN009D19+ AGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
JMSF031N02+ TNGGCCGAAAAAAAAAAGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATNTA
                      ____________________________________________________________
consensus TTGGCCGAAAAAAAAAAGTATGAAGTTTGGACAGTAATACAGCCATGCAATAAGCATCTA
 
. : . : . : . : . : . :
rJMFF005I13- ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
rJMFF033P15- ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
JMFN031E23+ ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
JMFN017D12+ ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
JMFN031K13+ ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
rJMSF031N02- ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
JMFN009D19+ ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTTGAAACTCGGCTAAACTGA
JMFF033P15+ TAAACTGA
JMSF031N02+ ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
                      ____________________________________________________________
consensus ATCAGATCAAACTACTTAAATGCTAAACCTACCGTTAATTTCGAAACTCGGCTAAACTGA
 
. : . : . : . : . : . :
rJMFF005I13- ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
rJMFF033P15- ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
JMFN031E23+ ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
JMFN017D12+ ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
JMFN031K13+ ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
rJMSF031N02- ATGATCAAGGCTCAAGACCTAGCCATCATC-TTTTGAATTCCTCGAAGTTAACGCAGCCG
JMFN009D19+ ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
JMFF033P15+ ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
JMSF031N02+ ATGATCAAGGCTCAAGACCTAGCCATCATC-TTTTGAATTCCTCGAAGTTAACGCAGCCG
                      ____________________________________________________________
consensus ATGATCAAGGCTCAAGACCTAGCCATCATCTTTTTGAATTCCTCGAAGTTAACGCAGCCG
 
. : . : . : . : . : . :
rJMFF005I13- TCGCC
rJMFF033P15- TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMFN031E23+ TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMFN017D12+ TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMFN031K13+ TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
rJMSF031N02- TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMFN009D19+ TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMFF033P15+ TCGCCGTCGACGTCGACGGAAGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
JMSF031N02+ TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
                      ____________________________________________________________
consensus TCGCCGTCGACGTCGACGG-AGCTAATCATGCGGCGGCAGTCCTTGAGCGAACACTTCTC
 
. : . : . : . : . : . :
rJMFF033P15- TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMFN031E23+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMFN017D12+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMFN031K13+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
rJMSF031N02- TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMFN009D19+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMFF033P15+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
JMSF031N02+ TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
                      ____________________________________________________________
consensus TCCGAGGCTCTTCATCACCGAGTGAAGCTCGCTGGCGGAGATCTTCCCGTTCTTATCCTT
 
. : . : . : . : . : . :
rJMFF033P15- GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMFN031E23+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMFN017D12+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMFN031K13+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
rJMSF031N02- GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMFN009D19+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMFF033P15+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
JMSF031N02+ GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
                      ____________________________________________________________
consensus GTCGTACAGGCTGAAGGCGTCGCGGAGGTCCTTGTCCTCGGAGTCGGATCCTCCGTCGCT
 
. : . : . : . : . : . :
rJMFF033P15- GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMFN031E23+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMFN017D12+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMFN031K13+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
rJMSF031N02- GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMFN009D19+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMFF033P15+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
JMSF031N02+ GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
                      ____________________________________________________________
consensus GGAGCAGTGGAAAGCCGCGAACTCCTCCATATCGATGAATCCGTCGCCGTCAGTATCGAC
 
. : . : . : . : . : . :
rJMFF033P15- CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMFN031E23+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMFN017D12+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMFN031K13+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
rJMSF031N02- CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMFN009D19+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMFF033P15+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
JMSF031N02+ CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
                      ____________________________________________________________
consensus CTCCAGCATTATGCGCTTCACCTCCTCCGCCGACGTCTTGGAGCCGAGCGCATTCAGAAT
 
. : . : . : . : . : . :
rJMFF033P15- CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMFN031E23+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMFN017D12+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMFN031K13+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
rJMSF031N02- CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMFN009D19+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMFF033P15+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
JMSF031N02+ CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
                      ____________________________________________________________
consensus CGCTCCGAGCTCCGACAGCGAGATTTTGCCGTCGCCATTCGAGTCAAACTTCCTGAACAC
 
. : . : . : . : . : . :
rJMFF033P15- CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMFN031E23+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMFN017D12+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMFN031K13+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
rJMSF031N02- CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMFN009D19+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMFF033P15+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
JMSF031N02+ CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
                      ____________________________________________________________
consensus CTTCTCCACTTCCCCCATCGCGCCGCCAGAAATCACCGCCGCTTTCGGATCGCTTCCGCT
 
. : . : . : . : . : . :
rJMFF033P15- TTTTGCCA
JMFN031E23+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTG
JMFN017D12+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACT
JMFN031K13+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACTTCTG
rJMSF031N02- TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACTTCTG
JMFN009D19+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGT
JMFF033P15+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACTTCTGGGAGACTTT
JMSF031N02+ TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACTTCTGGGAGACTTTTCCC
                      ____________________________________________________________
consensus TTTTGCCATTACAGAGAGAGACTATAATAGGGAAAGTGTGACTTCTGGGAGACTTTTCCC