Previous Contig 006763:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS066B01Sequence627006763 (8)
JMFS102C11Sequence604006763 (8)
JMFS117C06Sequence624006763 (8)
JMFS121E08Sequence576006763 (8)
JMFS152A05Sequence620006763 (8)
JMFS163B05Sequence618006763 (8)gb:ATAC009325_15428990.040Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc
JMSF031M17Sequence630006763 (8)704012153 (3)gb:AJ843981_18146732e-33Plantago major partial mRNA for hypothetical protein.
JMSF050I24Sequence289006763 (8)677012153 (3)gb:AJ843981_18146731e-28Plantago major partial mRNA for hypothetical protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163B05+ TATGCTAATGCTTCAACCACTTCAGAGAGACCGGAGTGCAAAACCTTC
JMFS152A05+ ATGCTTCAACCACTTCAGAGAGACCGGAGTGCAAAACCTTC
JMFS117C06+ ATGCTTCAACCACTTCAGAGAGACCGGAGTGCAAAACCTTC
JMFS102C11+ GAGAGACCGGAGTGCAAAACCTTC
JMFS066B01+ ATGCTTCAACCACTTCAGAGAGACCGGAGTGCAAAACCTTC
JMSF031M17+ ACTTCAGAGAGACCGGAGTGCAAAACCTTC
                      ____________________________________________________________
consensus TATGCTAATGCTTCAACCACTTCAGAGAGACCGGAGTGCAAAACCTTC
 
. : . : . : . : . : . :
JMFS163B05+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
JMFS152A05+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
JMFS117C06+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
JMFS102C11+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
JMFS121E08+ CTGAACGTGGCCGGGA
JMFS066B01+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
JMSF031M17+ TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
                      ____________________________________________________________
consensus TCTTCCAAGATTGCATCTAGCCGTGCCGGTTGAGTTAGAATGGTCTGAACGTGGCCGGGA
 
. : . : . : . : . : . :
JMFS163B05+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMFS152A05+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMFS117C06+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMFS102C11+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMFS121E08+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMFS066B01+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
JMSF031M17+ ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
                      ____________________________________________________________
consensus ATGGCAGCATTGGCGCGAGGCATTATATCCTCGATGAGGTGCAGGAGAGGTTTCACTTTG
 
. : . : . : . : . : . :
JMFS163B05+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMFS152A05+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMFS117C06+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMFS102C11+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMFS121E08+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMFS066B01+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
JMSF031M17+ TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
                      ____________________________________________________________
consensus TAGTGGACTGCATCCACGTCGTGAGTTGCTCTAACATGGTCCATCATGGTGGTATCCTCG
 
. : . : . : . : . : . :
JMFS163B05+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMFS152A05+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMFS117C06+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMFS102C11+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMFS121E08+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMFS066B01+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
JMSF031M17+ GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
                      ____________________________________________________________
consensus GAGCTAGCAAGAAGATCTCCCCTTCTATTCCTAAGATACCTACCAGCCGGAATGGGATTA
 
. : . : . : . : . : . :
JMFS163B05+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMFS152A05+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMFS117C06+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMFS102C11+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMFS121E08+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMFS066B01+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
JMSF031M17+ ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
                      ____________________________________________________________
consensus ACGGTTTTCGCCTTCAACGGGGCTACCACCGGGAGGGGTGCAGGGACAACAAGGCCACTG
 
. : . : . : . : . : . :
JMFS163B05+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMFS152A05+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMFS117C06+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMFS102C11+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMFS121E08+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMFS066B01+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
JMSF050I24+ GATGGCGTTGACGTTGGCCACGGTTGCAGGGACGNCAACTTCTTGGACT
JMSF031M17+ CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
                      ____________________________________________________________
consensus CTCAGTGGATTGATGGCGTTGACGTTGGCCACGGTTGCAGGGACGACAACTTCTTGGACT
 
. : . : . : . : . : . :
JMFS163B05+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMFS152A05+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMFS117C06+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMFS102C11+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMFS121E08+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMFS066B01+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMSF050I24+ GGGTAGGTGGGAGGAGTAGTANTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
JMSF031M17+ GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
                      ____________________________________________________________
consensus GGGTAGGTGGGAGGAGTAGTAGTATATCCCCTCGGGTTGATCTGGCCGGTGGTCCTAGGG
 
. : . : . : . : . : . :
JMFS163B05+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMFS152A05+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMFS117C06+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMFS102C11+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMFS121E08+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMFS066B01+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMSF050I24+ ATGATTTCGTGGGTCGGNTTAATGGTGNTACCAGGAGGAGGAATCGGAGTCACCATAGGA
JMSF031M17+ ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
                      ____________________________________________________________
consensus ATGATTTCGTGGGTCGGGTTAATGGTGGTACCAGGAGGAGGAATCGGAGTCACCATAGGA
 
. : . : . : . : . : . :
JMFS163B05+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMFS152A05+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMFS117C06+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMFS102C11+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMFS121E08+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMFS066B01+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
JMSF050I24+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGNNCTGATGGTTTGAGCCATTTTTCGAAGG
JMSF031M17+ GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
                      ____________________________________________________________
consensus GTGGTGTTGGTCACCCTAGGGATGTTATCAGTGCTGATGGTTTGAGCCATTTTTGGAAGG
 
. : . : . : . : . : . :
JMFS163B05+ TGGAGAAGAGAGGGTTTAGATAGCAATTAA
JMFS152A05+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGA
JMFS117C06+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAA
JMFS102C11+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAA
JMFS121E08+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAAGGGAA
JMFS066B01+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAAGGGAA
JMSF050I24+ TGGAGAAGAGAGGCATTAGATAGCAATTAAGAGATGAAAAGGGAAATGGATATT
JMSF031M17+ TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAAGGGAAATGGATATTGCTGGC
                      ____________________________________________________________
consensus TGGAGAAGAGAGGGTTTAGATAGCAATTAAGAGATGAAAAGGGAAATGGATATTGCTGGC