Previous Contig 006762:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031M13Sequence535006762 (2)478006762 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031M13+ GAGTAGAAACCCTCGTCTCTCCCTCACTGCTCATCTTACTCCTTGGCAACGAAAAGC
JMSF031M13- GAGTAGAAACCCTCGTCTCTCCCTCACTGCTCATCTTACTCCTTGGCAACGAAAAGC
                      ____________________________________________________________
consensus GAGTAGAAACCCTCGTCTCTCCCTCACTGCTCATCTTACTCCTTGGCAACGAAAAGC
 
. : . : . : . : . : . :
rJMSF031M13+ CTCCTTGATCATGGTGAAATCAAGAGGATGACACTCCAAATCACCAAAACAAATAGGAAG
JMSF031M13- CTCCTTGATCATGGTGAAATCAAGAGGATGACACTCCAAATCACCAAAACAAATAGGAAG
                      ____________________________________________________________
consensus CTCCTTGATCATGGTGAAATCAAGAGGATGACACTCCAAATCACCAAAACAAATAGGAAG
 
. : . : . : . : . : . :
rJMSF031M13+ AAGCACCAACCCTAATCAGAGCTCTTTGCAATTTTGAACACGAGGAACTCAGCCATTTCT
JMSF031M13- AAGCACCAACCCTAATCAGAGCTCTTTGCAATTTTGAACACGAGGAACTCAGCCATTTCT
                      ____________________________________________________________
consensus AAGCACCAACCCTAATCAGAGCTCTTTGCAATTTTGAACACGAGGAACTCAGCCATTTCT
 
. : . : . : . : . : . :
rJMSF031M13+ AATCCATCTTGATCGGGCGAGAACCTCGCGGCATGGAGGAATCTGGTCAAGCAAAGGCAA
JMSF031M13- AATCCATCTTGATCGGGCGAGAACCTCGCGGCATGGAGGAATCTGGTCAAGCAAAGGCAA
                      ____________________________________________________________
consensus AATCCATCTTGATCGGGCGAGAACCTCGCGGCATGGAGGAATCTGGTCAAGCAAAGGCAA
 
. : . : . : . : . : . :
rJMSF031M13+ CCCGAAGTAAACACCTTCCCAATTGTATTCTTGGAACTCCTTGGGTCAAAATCAACATCA
JMSF031M13- CCCGAAGTAAACACCTTCCCAATTGTATTCTTGGAACTCCTTGGGTCAAAATCAACATCA
                      ____________________________________________________________
consensus CCCGAAGTAAACACCTTCCCAATTGTATTCTTGGAACTCCTTGGGTCAAAATCAACATCA
 
. : . : . : . : . : . :
rJMSF031M13+ CTCGGAAGGTAACCCTTTAGATTAGACTATTATTTCATATGTTGTAGAACCCACTCCCCT
JMSF031M13- CTCGGAAGGTAACCCTTTAGATTAGACTATTATTTCATATGTTGTAGAACCCACTCCCCT
                      ____________________________________________________________
consensus CTCGGAAGGTAACCCTTTAGATTAGACTATTATTTCATATGTTGTAGAACCCACTCCCCT
 
. : . : . : . : . : . :
rJMSF031M13+ GCGTATGCATATGTTTGCTTTTGGTCTTGGTAATGATTTTGATGAAGATTTTTGGGTTGG
JMSF031M13- GCGTATGCATATGTTTGCTTTTGGTCTTGGTAATGATTTTGATGAAGATTTTTGGGTTGG
                      ____________________________________________________________
consensus GCGTATGCATATGTTTGCTTTTGGTCTTGGTAATGATTTTGATGAAGATTTTTGGGTTGG
 
. : . : . : . : . : . :
rJMSF031M13+ ACTTGAGGCTTTGCTAACATTTAAATGATGCATGTGGACCAATGAAGGTTTTGATATAGA
JMSF031M13- ACTTGAGGCTTTGCTAACATTTAAATGAT-CATGTGGA-CAATGAAGGTTTTGATATAGA
                      ____________________________________________________________
consensus ACTTGAGGCTTTGCTAACATTTAAATGATGCATGTGGACCAATGAAGGTTTTGATATAGA
 
. : . : . : . : . : . :
rJMSF031M13+ T
JMSF031M13- TTCACAAGGGAGAAGGGTAGATGATATTTCTGTGGGTATTTCCATTTGGCAAAAAAAAAA
                      ____________________________________________________________
consensus TTCACAAGGGAGAAGGGTAGATGATATTTCTGTGGGTATTTCCATTTGGCAAAAAAAAAA