Previous Contig 006761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M07Sequence510006761 (10)pir|A84857|A848571e-50probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi639008731 (8)pir|A84857|A848576e-44probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMFF014H17Sequence583006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi709008731 (8)pir|A84857|A848579e-50probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF001D23Sequence383006761 (10)pir|A84857|A848572e-31probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi750012764 (2)pir|A84857|A848575e-70probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF020B17Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi762008731 (8)pir|A84857|A848574e-59probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF021D11Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi777008731 (8)pir|A84857|A848572e-63probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF030A20Sequence663006761 (10)pir|A84857|A848576e-61probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi696008731 (8)pir|A84857|A848571e-53probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF031B22Sequence641006761 (10)pir|A84857|A848572e-67probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi681012764 (2)pir|A84857|A848571e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF031M12Sequence646006761 (10)pir|A84857|A848571e-57probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi762008731 (8)pir|A84857|A848572e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF044C04Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi709008731 (8)pir|A84857|A848577e-55probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF048J19Sequence660006761 (10)pir|A84857|A848572e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi776008731 (8)pir|A84857|A848572e-63probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031B22+ GGAGTTGTTCCCTTGCACTTAGGGTAGTGAAGCGCGAGTTTGGA
                      ____________________________________________________________
consensus GGAGTTGTTCCCTTGCACTTAGGGTAGTGAAGCGCGAGTTTGGA
 
. : . : . : . : . : . :
JMSF031B22+ TCCTTTGAAGTATAGAGTGTGAGCCAACCAAACATGACTTTGGGGACTTTATCATCTTCC
JMSF048J19+ GAAGTATAGAGCGTGTGCCAACCAAACATGACTTTGGGGACTTTATCATCATCC
JMSF030A20+ GAAGTATAGAGCGTGTGCCAACCAAACATGACTTTGGGGACTTTATCATCATCC
                      ____________________________________________________________
consensus TCCTTTGAAGTATAGAGCGTGTGCCAACCAAACATGACTTTGGGGACTTTATCATCATCC
 
. : . : . : . : . : . :
JMSF031B22+ TCATCC------CCCTTGTCGCCGTTAGTAATGGAACGAAGCAGAGACTCGGCGGATACC
JMSF048J19+ TCCTCCTNGTCGTCGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
JMSF021D11+ TCGTCGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
JMSF020B17+ TCGTCGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
JMSF044C04+ TCGTCGTTGTCACCACTAGTACTGGGACGAAGCAGAGGCTCGGCGGATACT
JMFF014H17+ CACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
JMSF030A20+ TCCTCCTNGTCGTCGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
JMSF031M12+ CGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
                      ____________________________________________________________
consensus TCCTCCTNGTCGTCGTTGTCACCACTAGTACTGGAACGAAGCAGAGGCTCGGCGGATACT
 
. : . : . : . : . : . :
JMSF031B22+ GGCTTGGCGATGAACACGTTGATCCACTCGAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF048J19+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF021D11+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF020B17+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF044C04+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMFF011M07+ CCGTGGTGGTGCCGCGAAACACCACG
JMFF014H17+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF030A20+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
JMSF031M12+ GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
                      ____________________________________________________________
consensus GGCTTGGCGCTGAACACGTTGATCCACTCCAGGTCCGTGGTGGTGCCGCGAAACACCACG
 
. : . : . : . : . : . :
JMSF031B22+ TAGATTTCGCGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTAGCCA
JMSF048J19+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMSF021D11+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMSF020B17+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMSF044C04+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMFF011M07+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMFF014H17+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMSF030A20+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
JMSF031M12+ TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
                      ____________________________________________________________
consensus TAGATTTCACGGCGGCCGAGGGCTTTACTGACGGCGTCGCTGGTAACGGCGACGTATCCA
 
. : . : . : . : . : . :
JMSF031B22+ ATCCAGTTAGATTCCCTGTCCCAAGATTCGCGGGAG-AGGGAGTGAAGGAGGAAGGCCTC
JMSF048J19+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF021D11+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF020B17+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF044C04+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF001D23+ AGATTCGCGGGAGAAGGGAGTGAAGGAGGAAGGCCTC
JMFF011M07+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMFF014H17+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF030A20+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
JMSF031M12+ ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
                      ____________________________________________________________
consensus ATCCAATTGGATTCCCGGTCCCAAGATTCGCGGGAG-CGGGAGTGAAGAAGGAAGGCCTC
 
. : . : . : . : . : . :
JMSF031B22+ CGGGACGGGGAGTTTGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF048J19+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF021D11+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF020B17+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF044C04+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF001D23+ CGGGACGGGGAGTTTGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMFF011M07+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMFF014H17+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF030A20+ CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
JMSF031M12+ CGGGACGGTGAGTTGGGAGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
                      ____________________________________________________________
consensus CGGGACGGTGAGTTGGGCGGTGGCGTAGAGGTAGGCCTCCACTTGGTAGTCGTCGGCGGA
 
. : . : . : . : . : . :
JMSF031B22+ TGGGAGCATTACTTTGTGGAAGAAGGAGCGTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF048J19+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF021D11+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF020B17+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF044C04+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF001D23+ TGGGAGCATTACTTTGTGGAAGAAGGAGCGTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMFF011M07+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMFF014H17+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF030A20+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
JMSF031M12+ TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
                      ____________________________________________________________
consensus TGGGAGCATGACTTTGTGGAAGAAGGAGTTTTTGCCGTAGCGGCAGCTGCCGGCGTACTT
 
. : . : . : . : . : . :
JMSF031B22+ GGAGTTGCTGTCGTTGTTGAAGGAGTCGTAGGTGGCTTGACAGAAGTCGCCACACCGGAG
JMSF048J19+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF021D11+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF020B17+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF044C04+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF001D23+ GGAGTTGCTGTCGTTGTTGAAGGAGTCGTAGGTGGCTTGACAGAAGTCGCCACACCGGAG
JMFF011M07+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMFF014H17+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF030A20+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
JMSF031M12+ GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
                      ____________________________________________________________
consensus GGAGTTGCTGTCGTGGTTGAAGGAGTCGTAGGTGGCTTGGCAGAAGTCGCCGCACCGGAG
 
. : . : . : . : . : . :
JMSF031B22+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF048J19+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF021D11+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF020B17+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF044C04+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF001D23+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMFF011M07+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMFF014H17+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF030A20+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
JMSF031M12+ AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
                      ____________________________________________________________
consensus AATGAGGTGCCGGAGGCTGAGGTTTAGAGGGTCCAGTAGACCTTCCCAGTTCTCGCTTCC
 
. : . : . : . : . : . :
JMSF031B22+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF048J19+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF021D11+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF020B17+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF044C04+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF001D23+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMFF011M07+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMFF014H17+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF030A20+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
JMSF031M12+ GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
                      ____________________________________________________________
consensus GAGCAGCTGATGCCATGTCGGTTCTGTCGCCATGGACTGAAAGTGGATAAAGCTTTTGAG
 
. : . : . : . : . : . :
JMSF031B22+ GAC
JMSF048J19+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF021D11+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF020B17+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF044C04+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF001D23+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTAGCATGAAGCCT
JMFF011M07+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAC
JMFF014H17+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF030A20+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
JMSF031M12+ GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
                      ____________________________________________________________
consensus GACAAAGATGGCTGCAGAGAAGATCAAGATATTGGCATGAAGCCTAAGGGATATTGTTAT
 
. : . : . : . : . : . :
JMSF048J19+ CCTTAC
JMSF021D11+ CCTT
JMSF020B17+ CCTT
JMSF044C04+ CCTT
JMFF011M07+ CCTT
JMFF014H17+ CCTTAC
JMSF030A20+ CCTTAC
JMSF031M12+ CCTTACAAACAAAATAATGAATGGTGAGGGGCTTTTGTAAGAGTAAACTAAATATGTCGC
                      ____________________________________________________________
consensus CCTTACAAACAAAATAATGAATGGTGAGGGGCTTTTGTAAGAGTAAACTAAATATGTCGC