Previous Contig 006760:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H07Sequence596006760 (5)gb:AY081347_15686934e-33Arabidopsis thaliana unknown protein (At2g28110) mRNA, complete cds.>gb:BT006256695008550 (4)pir|H84680|H846804e-24hypothetical protein At2g28110 [imported] - Arabidopsis thaliana>gb:AC005851_153
JMSF028I05Sequence661006760 (5)pir|H84680|H846805e-57hypothetical protein At2g28110 [imported] - Arabidopsis thaliana>gb:AC005851_153745008550 (4)pir|H84680|H846807e-38hypothetical protein At2g28110 [imported] - Arabidopsis thaliana>gb:AC005851_153
JMSF031M05Sequence660006760 (5)gb:AY081347_15686931e-11Arabidopsis thaliana unknown protein (At2g28110) mRNA, complete cds.>gb:BT006256664008550 (4)pir|H84680|H846809e-41hypothetical protein At2g28110 [imported] - Arabidopsis thaliana>gb:AC005851_153
JMSF032M05Sequence677006760 (5)gb:AY081347_15686932e-13Arabidopsis thaliana unknown protein (At2g28110) mRNA, complete cds.>gb:BT006256
JMSF034C23Sequence309006760 (5)524008550 (4)gb:BT011629_16411513e-04Arabidopsis thaliana At5g22940 mRNA, complete cds.>gb:BT014962_1641932 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028I05+ CCGGCACTCCATCGGCGATTGCTGTGTCCTCCAATGTGTG
                      ____________________________________________________________
consensus CCGGCACTCCATCGGCGATTGCTGTGTCCTCCAATGTGTG
 
. : . : . : . : . : . :
JMSF028I05+ AAAACATGACCCAAAATCGTGGGATGCGACGAAGACGTGGTCGGCGCCGCGGCTGCGGTT
                      ____________________________________________________________
consensus AAAACATGACCCAAAATCGTGGGATGCGACGAAGACGTGGTCGGCGCCGCGGCTGCGGTT
 
. : . : . : . : . : . :
JMSF028I05+ CCAGAAGGGAAGGTCAGAGGAAATGAGGCGAATGGCGGAGGAAATAAGATT-CCGGGCGT
JMFF008H07+ GCGGAGGAAATAAGATTCCCGGGCGT
                      ____________________________________________________________
consensus CCAGAAGGGAAGGTCAGAGGAAATGAGGCGAATGGCGGAGGAAATAAGATTCCCGGGCGT
 
. : . : . : . : . : . :
JMSF028I05+ GACCAATCGCCGGGAAGCCATTGACCGTGCTGAAATTGCAAGAAACGTAAACGGGGACGA
JMFF008H07+ GACCAATCGCCGGGAAGCCATTGACCGTGCTGAAATTGCAAGAAACGTAAACGGGGACGA
                      ____________________________________________________________
consensus GACCAATCGCCGGGAAGCCATTGACCGTGCTGAAATTGCAAGAAACGTAAACGGGGACGA
 
. : . : . : . : . : . :
JMSF028I05+ AGAAAAAGTCAGCCTCCCACGGGTCAAACGTGCGAACCTCGCTGCTCGCCAAGGCTCTGT
JMFF008H07+ AGAAAAAGTCAGCCTCCCACGGGTCAAACGTGCGAACCTCGCTGCTCGCCAAGGCTCTGT
JMSF032M05+ GCTCGCCAAGGCTCTGT
                      ____________________________________________________________
consensus AGAAAAAGTCAGCCTCCCACGGGTCAAACGTGCGAACCTCGCTGCTCGCCAAGGCTCTGT
 
. : . : . : . : . : . :
JMSF028I05+ GTATAGCCACCTCGGAAGCAAACAAATGGCTGCTACACCGCTCATTCAACCAATCAACGT
JMFF008H07+ GTATAGCCACCTCGGAAGCAAACAAATGGCTGCTACACCGCTCATTCAACCAATCAACGT
JMSF032M05+ GTATAGCCACCTCGGAAGCAAACAAATGGCTGCTACACCGCTCATTCAACCAATCAACGT
JMSF031M05+ GTATAGCCACCTCGGAAGCAAACAAATGGCTGCTACACCGCTCATTCAACCAATCAACGT
                      ____________________________________________________________
consensus GTATAGCCACCTCGGAAGCAAACAAATGGCTGCTACACCGCTCATTCAACCAATCAACGT
 
. : . : . : . : . : . :
JMSF028I05+ TATATTTCGCCGGCAAATCGTATATGTAAACCTTCAGATCCTTAAACACATCTTGGTGGG
JMSF034C23+ GTATATGTAAACCTTCNGATCCTTAAACACATCTNGGTGGG
JMFF008H07+ TATATTTCGCCGGCAAATCGTATATGTAAACCTTCAGATCCTTAAACACATCTTGGTGGG
JMSF032M05+ TATATTTCGCCGGCAAATCGTATATGTAAACCTTCAGATCCTTAAACACATCTTGGTGGG
JMSF031M05+ TATATTTCGCCGGCAAATCGTATATGTAAACCTTCAGATCCTTAAACACATCTTGGTGGG
                      ____________________________________________________________
consensus TATATTTCGCCGGCAAATCGTATATGTAAACCTTCAGATCCTTAAACACATCTTGGTGGG
 
. : . : . : . : . : . :
JMSF028I05+ TGTTGGGCTGGTGGAGAAGAGAAGAGTTATGGGATTCGATGAGGGCGCGAGAAGCTTTAG
JMSF034C23+ TGTTNGGCTNGTGGAGAAGAGAAGAGTTATGGGNTTCGATGAGGGCGCGAGNAGCTTTAG
JMFF008H07+ TGTTGGGCTGGTGGAGAAGAGAAGAGTTATGGGATTCGATGAGGGCGCGAGAAGCTTTAG
JMSF032M05+ TGTTGGGCTGGTGGAGAAGAGAAGAGTTATGGGATTCGATGAGGGCGCGAGAAGCTTTAG
JMSF031M05+ TGTTGGGCTGGTGGAGAAGAGAAGAGTTATGGGATTCGATGAGGGCGCGAGAAGCTTTAG
                      ____________________________________________________________
consensus TGTTGGGCTGGTGGAGAAGAGAAGAGTTATGGGATTCGATGAGGGCGCGAGAAGCTTTAG
 
. : . : . : . : . : . :
JMSF028I05+ ATTGGCGGACGACGGTGGTCCGGGAGATGATGGCGGAGGTGGCAGGTTTATGAGTGAAAA
JMSF034C23+ ATTGGCGGNCGACGGTGGTCCNGGAGATGATGGCNGAGGTGGCAGGTTTATGAGTGAAAA
JMFF008H07+ ATTGGCGGACGACGGTGGTCCGGGAGATGATGGCGGAGGTGGCAGGTTTATGAGTGAAAA
JMSF032M05+ ATTGGCGGACGACGGTGGTCCGGGAGATGATGGCGGAGGTGGCAGGTTTATGAGTGAAAA
JMSF031M05+ ATTGGCGGACGACGGTGGTCCGGGAGATGATGGCGGAGGTGGCAGGTTTATGAGTGAAAA
                      ____________________________________________________________
consensus ATTGGCGGACGACGGTGGTCCGGGAGATGATGGCGGAGGTGGCAGGTTTATGAGTGAAAA
 
. : . : . : . : . : . :
JMSF028I05+ TGAAAGAGGCGAAGAAATAGAAAGAAAGGGAAAACCAGAGAAGCCATTTGAAATATCTAT
JMSF034C23+ TGAAAGAGGCGAAGAAATAGAAAGAAANGGAAAACCAGAGAAGCCATTTGAAATATCTAT
JMFF008H07+ TGAAAGAGGCGAAGAAATAGAAAGAAAGGGAAAACCAGAGAAGCCATTTGAAATATCTAT
JMSF032M05+ TGAAAGAGGCGAAGAAATAGAAAGAAAGGGAAAACCAGAGAAGCCATTTGAAATATCTAT
JMSF031M05+ TGAAAGAGGCGAAGAAATAGAAAGAAAGGGAAAACCAGAGAAGCCATTTGAAATATCTAT
                      ____________________________________________________________
consensus TGAAAGAGGCGAAGAAATAGAAAGAAAGGGAAAACCAGAGAAGCCATTTGAAATATCTAT
 
. : . : . : . : . : . :
JMSF028I05+ GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
JMSF034C23+ GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
JMFF008H07+ GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
JMSF032M05+ GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
JMSF031M05+ GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
                      ____________________________________________________________
consensus GGCAGAAGCTCTTCTCAGAGGCCTGTCTTCCTGGTCTCAACAACTTCATCCTCACATAAA
 
. : . : . : . : . : . :
JMSF028I05+ ACCCTTTGTTCCTCGAAGTTT
JMSF034C23+ NCCCTTTGTTCCTCNAAGTTTG
JMFF008H07+ ACCCTTTGTTCCTCGAAGTTTGTCTTCTCATCTCCGTCATCTCTCCCCTATTAATCGATC
JMSF032M05+ ACCCTTTGTTCCTCGAAGTTTGTCTTCTCATCTCCGTCATCTCTCCCCTATTAATCGATC
JMSF031M05+ ACCCTTTGTTCCTCGAAGTTTGTCTTCTCATCTCCGTCATCTCTCCCCTATTAATCGATC
                      ____________________________________________________________
consensus ACCCTTTGTTCCTCGAAGTTTGTCTTCTCATCTCCGTCATCTCTCCCCTATTAATCGATC
 
. : . : . : . : . : . :
JMFF008H07+ AAAACAGGGGAGGCGACGGAGCTCCAG
JMSF032M05+ AAAACAGGGGAGGCGACGGAGCTCCAGCCCAGCCTGCAGGTGAGAGGTGGCTATCGGGGT
JMSF031M05+ AAAACAGGGGAGGCGACGGAGCTCCAGCCCAGCCTGCAGGTGAGAGGTGGCTATCGGGGT
                      ____________________________________________________________
consensus AAAACAGGGGAGGCGACGGAGCTCCAGCCCAGCCTGCAGGTGAGAGGTGGCTATCGGGGT
 
. : . : . : . : . : . :
JMSF032M05+ TTGGTTTTGGTCTGAAGTAGAATCCAAGAAACAAGGGTGAAAACTGAAAATTTTGAAAAA
JMSF031M05+ TTGGTTTTGGTCTGAAGTAGAATCCAAGAAACAAGGGTGAAAACTGAAAATTTTGAAAAA
                      ____________________________________________________________
consensus TTGGTTTTGGTCTGAAGTAGAATCCAAGAAACAAGGGTGAAAACTGAAAATTTTGAAAAA
 
. : . : . : . : . : . :
JMSF032M05+ AGAATGGTTTTTTGGTTGATGGTTCGTTTTAGCTTGAAGAATAAAGAATTAAACAAATAT
JMSF031M05+ AGAATGGTTTTTTGGTTGATGGTTCGTTTTAGCTTGAAGAATAAAGAATTAAACAAATAT
                      ____________________________________________________________
consensus AGAATGGTTTTTTGGTTGATGGTTCGTTTTAGCTTGAAGAATAAAGAATTAAACAAATAT
 
. : . : . : . : . : . :
JMSF032M05+ GATGTGGTGTATAAGATAAGTTACCCAAAATAATCAAGAACTATATTTTTGTTAAATTCC
JMSF031M05+ GATGTGGTGTATAAGATAAGTTACCCAAAATAATCAAGAACTATATTTTTGTTAAATTCC
                      ____________________________________________________________
consensus GATGTGGTGTATAAGATAAGTTACCCAAAATAATCAAGAACTATATTTTTGTTAAATTCC