Previous Contig 006756:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021F06Sequence620006756 (5)gb:AF302665_17843169e-21Arabidopsis thaliana ubiquitin-specific protease 15 (UBP15) gene, complete cds.
JMFS054B11Sequence626006756 (5)gb:AF302665_17843169e-21Arabidopsis thaliana ubiquitin-specific protease 15 (UBP15) gene, complete cds.
JMFS146B06Sequence626006756 (5)gb:AF302665_17843169e-21Arabidopsis thaliana ubiquitin-specific protease 15 (UBP15) gene, complete cds.
JMSF023A11Sequence678006756 (5)gb:AF302665_17843161e-20Arabidopsis thaliana ubiquitin-specific protease 15 (UBP15) gene, complete cds.736012284 (2)gb:AP005004_18471435e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMSF031L01Sequence646006756 (5)gb:AF302665_17843163e-11Arabidopsis thaliana ubiquitin-specific protease 15 (UBP15) gene, complete cds.335012284 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS054B11+ AGACC
JMFS146B06+ AGACC
JMFS021F06+ GCACTTATGTTACTATCAACTGAGACC
JMSF023A11+ AGAAACTGTGCACTTATGTTACTATCAACTGAGACC
                      ____________________________________________________________
consensus AGAAACTGTGCACTTATGTTACTATCAACTGAGACC
 
. : . : . : . : . : . :
JMFS054B11+ CGTCCAGGGAGCTCTTCCAATAGCTGGCACTCTTGTTTGTGAATTTCCCTCCAATGGAGA
JMFS146B06+ CGTCCAGGGAGCTCTTCCAATAGCTGGCACTCTTGTTTGTGAATTTCCCTCCAATGGAGA
JMFS021F06+ CGTCCAGGGAGCTCTTCCAATAGCTGGCACTCTTGTTTGTGAATTTCCCTCCAATGGAGA
JMSF023A11+ CGTCCAGGGAGCTCTTCCAATAGCTGGCACTCTTGTTTGTGAATTTCCCTCCAATGGAGA
                      ____________________________________________________________
consensus CGTCCAGGGAGCTCTTCCAATAGCTGGCACTCTTGTTTGTGAATTTCCCTCCAATGGAGA
 
. : . : . : . : . : . :
JMFS054B11+ ATCTGGCACTTGCCCGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
JMFS146B06+ ATCTGGCACTTGCCCGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
JMFS021F06+ ATCTGGCACTTGCCCGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
JMSF023A11+ ATCTGGCACTTGCCCGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
JMSF031L01+ CGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
                      ____________________________________________________________
consensus ATCTGGCACTTGCCCGAACAATAGCGAACAGACTTGCATCTAGAGCACCGAGTTGTTGCT
 
. : . : . : . : . : . :
JMFS054B11+ TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
JMFS146B06+ TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
JMFS021F06+ TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
JMSF023A11+ TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
JMSF031L01+ TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
                      ____________________________________________________________
consensus TGACCATAGCACCTTGCACACTGATGAAGCGAAGTATTTGGCAAAGGCACACTTGGCACA
 
. : . : . : . : . : . :
JMFS054B11+ CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
JMFS146B06+ CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
JMFS021F06+ CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
JMSF023A11+ CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
JMSF031L01+ CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
                      ____________________________________________________________
consensus CTTGCAACCTGATGAAGTGAATTGCTCGGCAAAGGTACAGGTACAGGTACAGGAGGAAAG
 
. : . : . : . : . : . :
JMFS054B11+ ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
JMFS146B06+ ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
JMFS021F06+ ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
JMSF023A11+ ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
JMSF031L01+ ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
                      ____________________________________________________________
consensus ACATTGGCAGCAGACATGGCTTCTACCCTAAAAGCTTCTTCAGCAGCCTGTTGAGCTAAT
 
. : . : . : . : . : . :
JMFS054B11+ ACACTTGCCCTCCCTTTCTTTTTTGCAGCCTCATTCCATTTTCCTAGGAAGATGTAAATA
JMFS146B06+ ACACTTGCCCTCCCTTTCTTTTTTGCAGCCTCATTCCATTTTCCTAGGAAGATGTAAATA
JMFS021F06+ ACACTTGCCCTCCCTTTCTTTTTTGCAGCCTCATTCCATTTTCCTAGGAAGATGTAAATA
JMSF023A11+ ACACTTGCCCTCCCTTTCTTTTTTGCAGCCCCATTCCATTTTCCTAGGAAGATGTAAATA
JMSF031L01+ ACACTTGCCCTCCCTTCCTTTTTTGCAGCCTCATTCCATTTTCCTAGGAAGATGTAAATA
                      ____________________________________________________________
consensus ACACTTGCCCTCCCTTTCTTTTTTGCAGCCTCATTCCATTTTCCTAGGAAGATGTAAATA
 
. : . : . : . : . : . :
JMFS054B11+ ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
JMFS146B06+ ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
JMFS021F06+ ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
JMSF023A11+ ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
JMSF031L01+ ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
                      ____________________________________________________________
consensus ACAAGCGGAAGCACAACTAGGAACAAAAACAGAGCAAGAACATCGGTTTCACTTGGCTGG
 
. : . : . : . : . : . :
JMFS054B11+ AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
JMFS146B06+ AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
JMFS021F06+ AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
JMSF023A11+ AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
JMSF031L01+ AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
                      ____________________________________________________________
consensus AGCATGATCCCACCAGAAAACTCATGTCCAATTTGCCGAAACTCCTCCTTGAGAACACTG
 
. : . : . : . : . : . :
JMFS054B11+ ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
JMFS146B06+ ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
JMFS021F06+ ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
JMSF023A11+ ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
JMSF031L01+ ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
                      ____________________________________________________________
consensus ATCACCTTTAGCTTTCTGCATAAGAGGCAAATCAGGAGAATAACACCCTTGGTCTCTTTT
 
. : . : . : . : . : . :
JMFS054B11+ GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAATGGTAAG
JMFS146B06+ GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAATGGTAAG
JMFS021F06+ GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAA
JMSF023A11+ GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAATGGTAAG
JMSF031L01+ GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAATGGTAAG
                      ____________________________________________________________
consensus GCAGCTCCTGGTTCTTCTCTTGTTAGCTCGGAAAGATACTTTTATTCCTCAAATGGTAAG
 
. : . : . : . : . : . :
JMFS054B11+ AAATCCACCGCTTCTGCTC
JMFS146B06+ AAATCCACCGCTTCTGCTC
JMSF023A11+ AAATCCACCGCTTCTGCTCTCCATTGGCCTGCCTGGCTTC
JMSF031L01+ AAATCCACCGCTTCTGCTCTCCATTGGCCTGCCTGGCTTCACAAAATGCCTCCCTTCTTC
                      ____________________________________________________________
consensus AAATCCACCGCTTCTGCTCTCCATTGGCCTGCCTGGCTTCACAAAATGCCTCCCTTCTTC
 
. : . : . : . : . : . :
JMSF031L01+ TCACTACTCGTTTGCACTTTAAGATTGGGGAATACTCGTCTGTGCTCACTCCACACTCTC
                      ____________________________________________________________
consensus TCACTACTCGTTTGCACTTTAAGATTGGGGAATACTCGTCTGTGCTCACTCCACACTCTC