Previous Contig 006755:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036M07Sequence550006755 (3)gb:AC084765_17337466e-40Oryza sativa chromosome 3 BAC OSJNBa0090L05 genomic sequence, complete sequence.
JMSF006H23Sequence290006755 (3)gb:AP004339_18404512e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P051369005717 (14)sp|O04066|ACBP_RICCO8e-26Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMSF031K23Sequence657006755 (3)gb:AP004339_18404517e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031K23+ TCCAACCTTCACTACCATTAACATCACCTTGAACTCTTACTACTGATTGATGTCAAC
                      ____________________________________________________________
consensus TCCAACCTTCACTACCATTAACATCACCTTGAACTCTTACTACTGATTGATGTCAAC
 
. : . : . : . : . : . :
JMSF031K23+ AGAACTCTTACTCTACTTGATATCAACATCACTCTTAATACTTGATTGATGGCTTCAAAA
                      ____________________________________________________________
consensus AGAACTCTTACTCTACTTGATATCAACATCACTCTTAATACTTGATTGATGGCTTCAAAA
 
. : . : . : . : . : . :
JMSF031K23+ CTCTTTTTCACTGCTAAATCTCAACAATTTTAATAAAACAAACCTAACTTAAATATCAAA
                      ____________________________________________________________
consensus CTCTTTTTCACTGCTAAATCTCAACAATTTTAATAAAACAAACCTAACTTAAATATCAAA
 
. : . : . : . : . : . :
JMSF031K23+ TGAGTAAAGATGAACCCACCATCATATAAACATCCACATTACCAGACTTGAATAGTATAG
                      ____________________________________________________________
consensus TGAGTAAAGATGAACCCACCATCATATAAACATCCACATTACCAGACTTGAATAGTATAG
 
. : . : . : . : . : . :
JMSF031K23+ AGTTCACACTTATTTCCTGAAAATGTATGACTAACCGATTTTTTTTCAAAAAATAAAATC
                      ____________________________________________________________
consensus AGTTCACACTTATTTCCTGAAAATGTATGACTAACCGATTTTTTTTCAAAAAATAAAATC
 
. : . : . : . : . : . :
JMFF036M07+ CCAGTGTAGTAATC
JMSF031K23+ CAATAAGGCAAGAAGATGAATACAATGAGATTCAATGCAAGCTCACCCAGTGTAGTAATC
                      ____________________________________________________________
consensus CAATAAGGCAAGAAGATGAATACAATGAGATTCAATGCAAGCTCACCCAGTGTAGTAATC
 
. : . : . : . : . : . :
JMFF036M07+ TCTTGGCAAATAGATGTCCTTAAGAGGGCCAAATTGCGCAAATGGCCTTCGCAGATCTTC
JMSF006H23+ AATAGATGTCCTTAAGAGGGCCAAATTGCGCAAATGGCCTTCGCAGATCTTC
JMSF031K23+ TCTTGGCAAATAGATGTCCTTAAGAGGGCCAAATTGCGCAAATGGCCTTCGCAGATCTTC
                      ____________________________________________________________
consensus TCTTGGCAAATAGATGTCCTTAAGAGGGCCAAATTGCGCAAATGGCCTTCGCAGATCTTC
 
. : . : . : . : . : . :
JMFF036M07+ AGGCCGACAATCGCGGCGAAGATTACGAACTAAAAGGCTAGTTGGGCCATCTCTGGAACG
JMSF006H23+ AGGCCGACAATCGCGGCGAAGATTACGAACTAAAAGGCTAGTTGGGCCATCTCTGGAACG
JMSF031K23+ AGGCCGACAATCGCGGCGAAGATTACGAACTAAAAGGCTAGTTGGGCCATCTCTGGAACG
                      ____________________________________________________________
consensus AGGCCGACAATCGCGGCGAAGATTACGAACTAAAAGGCTAGTTGGGCCATCTCTGGAACG
 
. : . : . : . : . : . :
JMFF036M07+ TCCACCATAGCGACCTCTGGGACTAGGGCTCCTTCCCCTTCTGCCATAACCTCTAGGTGG
JMSF006H23+ TCCACCATAGCGACCTCTGGGACTAGGGCTCCTTCCCCTTCTGCCATAACCTCTAGGTGG
JMSF031K23+ TCCACCATAGCGACCTCTGGGACTAGGGCTCCTTCCCCTTCTGCCATAACCTCTAGGTGG
                      ____________________________________________________________
consensus TCCACCATAGCGACCTCTGGGACTAGGGCTCCTTCCCCTTCTGCCATAACCTCTAGGTGG
 
. : . : . : . : . : . :
JMFF036M07+ TGGTGATGGGGTGTAGCTTCTTCCCCTCATTTATGTAAGACCTGAAAGCGAAGAACGACG
JMSF006H23+ TGGTGATGGGGTGTAGCTTCTTCCCCTCATTTATGTAAGACCTGAAAGCGAAGAACGACG
JMSF031K23+ TGGTGATGGGGTGTAGCTTCTTCCCCTCATTTATGTAAGACCTGAAAGCGAAGAACGACG
                      ____________________________________________________________
consensus TGGTGATGGGGTGTAGCTTCTTCCCCTCATTTATGTAAGACCTGAAAGCGAAGAACGACG
 
. : . : . : . : . : . :
JMFF036M07+ AGATTGAAAACGCTGGCGAGAGATAGGGAGACGGCGATAGGAGATT
JMSF006H23+ AGATTGAAAACGCTGGCGAGAGATAGGGAGACGGCGATAGGAGATTGA
JMSF031K23+ AGATTGAAAACGCTGGCGAGAGATAGGGAGACGGCGATAGGAGATTGAGAGCAAAAGACC
                      ____________________________________________________________
consensus AGATTGAAAACGCTGGCGAGAGATAGGGAGACGGCGATAGGAGATTGAGAGCAAAAGACC