Previous Contig 006744:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027A13Sequence542006744 (5)gb:AY087647_15726761e-62Arabidopsis thaliana clone 37331 mRNA, complete sequence.643006744 (5)pir|T00593|T024802e-62sec13-related protein At2g30050 - Arabidopsis thaliana>gb:AC004165_1531519 Arabi
JMFN010O10Sequence617006744 (5)pir|T00593|T024802e-88sec13-related protein At2g30050 - Arabidopsis thaliana>gb:AC004165_1531519 Arabi
JMFN018B15Sequence610006744 (5)pir|T00593|T024804e-89sec13-related protein At2g30050 - Arabidopsis thaliana>gb:AC004165_1531519 Arabi
JMSF031I07Sequence677006744 (5)gb:AY087647_15726762e-81Arabidopsis thaliana clone 37331 mRNA, complete sequence.393023480

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018B15+ AAAGATGTCTTGGATAGAGATATAGACTAACTGGAAGTCT
rJMFF027A13- TCT
JMFN010O10+ AAAGGAGAAGTCGGCAAAAGATGTCTTGGATAGAGATATAGACTAACTGGAAGTCT
                      ____________________________________________________________
consensus AAAGGAGAAGTCGGCAAAAGATGTCTTGGATAGAGATATAGACTAACTGGAAGTCT
 
. : . : . : . : . : . :
JMFN018B15+ ATTGGTCAACAGTTGTGACCTGTTGCCACTCCCCGTCAACTGCTTCATTCCATAGTGTGA
rJMFF027A13- ATTGGTCAACAGTTGTGACCTGTTGCCACTCCCCGTCAACTGCTTCATTCCATAGTGTGA
JMFN010O10+ ATTGGTCAACAGTTGTGACCTGTTGCCACTCCCCGTCAACTGCTTCATTCCATAGTGTGA
                      ____________________________________________________________
consensus ATTGGTCAACAGTTGTGACCTGTTGCCACTCCCCGTCAACTGCTTCATTCCATAGTGTGA
 
. : . : . : . : . : . :
JMFN018B15+ CATTGTTGTCCCCAGAAGCTACGGCTAACAGGTTTCCAGTCAAAGACCATGAGACCCTCC
rJMFF027A13- CATTGTTGTCCCCAGAANCTACGGCTAACNGGTTTCCAGTCAAAGACCATGANACCCTCC
JMFN010O10+ CATTGTTGTCCCCAGAAGCTACGGCTAACAGGTTTCCAGTCAAAGACCATGAGACCCTCC
                      ____________________________________________________________
consensus CATTGTTGTCCCCAGAAGCTACGGCTAACAGGTTTCCAGTCAAAGACCATGAGACCCTCC
 
. : . : . : . : . : . :
JMFN018B15+ AAACGGGTGTGTTAAAGTCATACAAAACCTTTCCTTCCCACTGATCTCCTTCTTTTGCCA
rJMFF027A13- AAACGGGTGTGTTAAAGTCATACAAAACCTTTCCTTCCCACTGATCTCCTTCTTTTGCCA
JMFN010O10+ AAACGGGTGTGTTAAAGTCATACAAAACCTTTCCTTCCCACTGATCTCCTTCTTTTGCCA
                      ____________________________________________________________
consensus AAACGGGTGTGTTAAAGTCATACAAAACCTTTCCTTCCCACTGATCTCCTTCTTTTGCCA
 
. : . : . : . : . : . :
JMFN018B15+ CAGTCCATATCACAACTTTACCATCCTCTGAAGCACTTGCAATTGTTGATTTTGGAAGCC
rJMFF027A13- CAGTCCATATCACAACTTTACCATCCTCTGAAGCACTTGCAATTGTTGATTTTGGAAGCC
JMFN010O10+ CAGTCCATATCACAACTTTACCATCCTCTGAAGCACTTGCAATTGTTGATTTTGGAAGCC
                      ____________________________________________________________
consensus CAGTCCATATCACAACTTTACCATCCTCTGAAGCACTTGCAATTGTTGATTTTGGAAGCC
 
. : . : . : . : . : . :
JMFN018B15+ CCAAATTGGGTGCCCACGCAACATCCCTCACCCAGTTAGTGTGCATCTGAAGGGCAGGGA
rJMFF027A13- CCAAATTGGGTGCCCACGCAACATCCCTCACCCAGNTAGTGTGCATCTGAAGGGCAGGGA
JMFN010O10+ CCAAATTGGGTGCCCACGCAACATCCCTCACCCAGTTAGTGTGCATCTGAAGGGCAGGGA
                      ____________________________________________________________
consensus CCAAATTGGGTGCCCACGCAACATCCCTCACCCAGTTAGTGTGCATCTGAAGGGCAGGGA
 
. : . : . : . : . : . :
JMFN018B15+ AGCAATCCATCTTCCAAACACCATTATAAAGCTTCCACACCTTCACAGTGTTATCACACC
rJMFF027A13- AGCAATCCATCTTCCAAACACCATTATAAAGCTTCCACACCTTCACAGTGTTATCACACC
JMFN010O10+ AGCAATCCATCTTCCAAACACCATTATAAAGCTTCCACACCTTCACAGTGTTATCACACC
                      ____________________________________________________________
consensus AGCAATCCATCTTCCAAACACCATTATAAAGCTTCCACACCTTCACAGTGTTATCACACC
 
. : . : . : . : . : . :
JMFN018B15+ CAGCTGATGCAAGCTTCTGAACAGGGTCATGTAAACCAGAACCAACTAAAGCACCGGGAG
rJMFF027A13- CANCTGATGCAAGCTTCTGAACAGGGTCNTGTAAACCAGAACCANCTAAAGCACCGGGAG
JMFN010O10+ CAGCTGATGCAAGCTTCTGAACAGGGTCATGTAAACCAGAACCAACTAAAGCACCGGGAG
JMSF031I07+ AACTAAAGCACCGGGAG
                      ____________________________________________________________
consensus CAGCTGATGCAAGCTTCTGAACAGGGTCATGTAAACCAGAACCAACTAAAGCACCGGGAG
 
. : . : . : . : . : . :
JMFN018B15+ CCATTGAAGGTGCCCATGAAACTGCAGTTACTCCAATAGGATGGGCCTGGTCTATTCTTG
rJMFF027A13- CCATTGA
JMFN010O10+ CCATTGAAGGTGCCCATGAAACTGCAGTTACTCCAATAGGATGGGCCTGGTCTATTCTTG
JMSF031I07+ CCATTGAAGGTGCCCATGAAACTGCAGTTACTCCAATAGGATGGGCCTGGTCTATTCTTG
                      ____________________________________________________________
consensus CCATTGAAGGTGCCCATGAAACTGCAGTTACTCCAATAGGATGGGCCTGGTCTATTCTTG
 
. : . : . : . : . : . :
JMFN018B15+ CAGTGTCCCAACCACCATCTGACCTCGCGGTGTAAACAGAGATGTTCCCATCAGATGATC
JMFN010O10+ CAGTGTCCCAACCACCATCTGACCTCGCGGTGTAAACAGAGATGTTCCCATTAGATGATC
JMFF027A13+ TAAACAGAGATGTTCCCATCAGATGATC
JMSF031I07+ CAGTGTCCCAACCACCATCTGACCTCGCGGTGTAAACAGAGATATTCCCATCAGATGATC
                      ____________________________________________________________
consensus CAGTGTCCCAACCACCATCTGACCTCGCGGTGTAAACAGAGATGTTCCCATCAGATGATC
 
. : . : . : . : . : . :
JMFN018B15+ CACATGCCAAGCAAAGCCCAA
JMFN010O10+ CACATGCCAAGCAAAGCCCAA
JMFF027A13+ CACATGCCAAGCAAAGCCCAAGTTCATGAGGAGCCCACGAAATAGAATTAACTGAAGATT
JMSF031I07+ CACATGCCAAGCAAAGCCCAAGTTCATGAGGAGCCCACGAAATAGAATTAACTGAAGATT
                      ____________________________________________________________
consensus CACATGCCAAGCAAAGCCCAAGTTCATGAGGAGCCCACGAAATAGAATTAACTGAAGATT
 
. : . : . : . : . : . :
JMFF027A13+ TGTGATCATTGAAAACATGAGCTTGTGTCCACTCATTTTGATTCCCTTCCTTCCAAACAA
JMSF031I07+ TGTGATCATTGAAAACATGAGCTTGTGTCCACTCATTTTGATTCCCTTCCTTCCAAACAA
                      ____________________________________________________________
consensus TGTGATCATTGAAAACATGAGCTTGTGTCCACTCATTTTGATTCCCTTCCTTCCAAACAA
 
. : . : . : . : . : . :
JMFF027A13+ TGACTTTACCATCAAATGAACAGGAAGCCAGTAGTGAACCAAATTTAGGGTGTGCCCATG
JMSF031I07+ TGACTTTACCATCAAATGAACAGGAAGCCAGTAGTGAACCAAATTTAGGGTGTGCCCATG
                      ____________________________________________________________
consensus TGACTTTACCATCAAATGAACAGGAAGCCAGTAGTGAACCAAATTTAGGGTGTGCCCATG
 
. : . : . : . : . : . :
JMFF027A13+ AAACCTGCCAAACTGGACCATGATGACCGGCCAGAGTAGCAAGGTGCTGTGAAGTAGAGT
JMSF031I07+ AAACCTGCCAAACTGGACCATGATGACCGGCCAGAGTAGCAAGGTGCTGTGAAGTAGAGT
                      ____________________________________________________________
consensus AAACCTGCCAAACTGGACCATGATGACCGGCCAGAGTAGCAAGGTGCTGTGAAGTAGAGT
 
. : . : . : . : . : . :
JMFF027A13+ TGTTGCTCACACCAATTATCTTGATGGAGGCATCAGATGAAGCTGTCGCCACACGTTTTC
JMSF031I07+ TGTTGCTCACACCAATTATCTTGATGGAGGCATCAGATGAAGCTGTCGCCACACGTTTTC
                      ____________________________________________________________
consensus TGTTGCTCACACCAATTATCTTGATGGAGGCATCAGATGAAGCTGTCGCCACACGTTTTC
 
. : . : . : . : . : . :
JMFF027A13+ CATAGTAATCCATAGACACATCGTGAACTGTGTCACTGTGCCCTGTTTCAATTTTCTGTG
JMSF031I07+ CATAGTAATCCATAGACACATCGTGAACTGTGTCACTGTGCCCTGTTTCAATTTTCTGTG
                      ____________________________________________________________
consensus CATAGTAATCCATAGACACATCGTGAACTGTGTCACTGTGCCCTGTTTCAATTTTCTGTG
 
. : . : . : . : . : . :
JMFF027A13+ CAGGCATCTTTCCTT
JMSF031I07+ CAGGCATCTTTCCTTCCTTGTCACTACTACGTATGAATGTATGATCACCCTGGAACAGAG
                      ____________________________________________________________
consensus CAGGCATCTTTCCTTCCTTGTCACTACTACGTATGAATGTATGATCACCCTGGAACAGAG
 
. : . : . : . : . : . :
JMSF031I07+ AATGTAACCGGGGATCGGCAGATCAGGTCAGAGGAAAACGCTGCGAACAGGAGAGGGAGA
                      ____________________________________________________________
consensus AATGTAACCGGGGATCGGCAGATCAGGTCAGAGGAAAACGCTGCGAACAGGAGAGGGAGA
 
. : . : . : . : . : . :
JMSF031I07+ AACAGTCGCTACCCGGGAAACCTGAACACAGAGCAAACTATAGCCGACAATCAAATCCTC
                      ____________________________________________________________
consensus AACAGTCGCTACCCGGGAAACCTGAACACAGAGCAAACTATAGCCGACAATCAAATCCTC