Previous Contig 006739:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044N07Sequence589006739 (7)gb:AY101603_15776576e-50Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.
JMFF051P06Sequence564006739 (7)gb:AY101603_15776572e-69Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.125021951
JMSF012A13Sequence438006739 (7)gb:AY101603_15776572e-44Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.
JMSF018B18Sequence215006739 (7)gb:AY101603_15776574e-07Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.793022809gb:AY101603_15776576e-19Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.
JMSF022K14Sequence648006739 (7)gb:AY101603_15776574e-78Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.
JMSF028C20Sequence697006739 (7)gb:AY101603_15776577e-65Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.763012591 (6)gb:AP001278_18209074e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08
JMSF031H11Sequence631006739 (7)gb:AY101603_15776572e-46Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.105023476

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028C20+ GATCAAAACCATTAGTTCCATACTGAAACTGGACATCATTATTATTGCTAATGCAATT
                      ____________________________________________________________
consensus GATCAAAACCATTAGTTCCATACTGAAACTGGACATCATTATTATTGCTAATGCAATT
 
. : . : . : . : . : . :
JMSF028C20+ TATGACATCTCCATAAAAATAGGAAGATCCAAACTCCGGCATCTGTTCATATGTGGGAGA
                      ____________________________________________________________
consensus TATGACATCTCCATAAAAATAGGAAGATCCAAACTCCGGCATCTGTTCATATGTGGGAGA
 
. : . : . : . : . : . :
JMSF028C20+ ATATATAGGCCCAGTAGAAGGGTCAATAAAGAATTTCAATGCGTCTAGGTCAGGATCAGC
                      ____________________________________________________________
consensus ATATATAGGCCCAGTAGAAGGGTCAATAAAGAATTTCAATGCGTCTAGGTCAGGATCAGC
 
. : . : . : . : . : . :
JMSF028C20+ TGGATTAGAAGTAATGTCTAACACTTGATCCTCGGTGGTATCAGCAATACAGCTATTGCT
                      ____________________________________________________________
consensus TGGATTAGAAGTAATGTCTAACACTTGATCCTCGGTGGTATCAGCAATACAGCTATTGCT
 
. : . : . : . : . : . :
JMSF028C20+ GTTACTATCAATAGGGAAATGAACACCAGGAGTTTCCTCGGAACTCTGACCCGGAGTTAA
                      ____________________________________________________________
consensus GTTACTATCAATAGGGAAATGAACACCAGGAGTTTCCTCGGAACTCTGACCCGGAGTTAA
 
. : . : . : . : . : . :
JMSF028C20+ AGGCTGTGTCTTGATGTGGCCGCTCTTCATTAATGGAGTCCCACCTTCTGATTGTTCATC
                      ____________________________________________________________
consensus AGGCTGTGTCTTGATGTGGCCGCTCTTCATTAATGGAGTCCCACCTTCTGATTGTTCATC
 
. : . : . : . : . : . :
JMSF028C20+ TTCTGCAGGTGTCTTAACGACTGTAGGAGAAGAGACAATTGGATCAACCTCATCACTGTT
                      ____________________________________________________________
consensus TTCTGCAGGTGTCTTAACGACTGTAGGAGAAGAGACAATTGGATCAACCTCATCACTGTT
 
. : . : . : . : . : . :
JMSF028C20+ TGAAATTTCAGCACCCTCATCCAGCTTCAACTCAACCTTCCTAAACAAACGGCAAAGCAC
JMSF022K14+ TTCAGCACCNTCATCCAGCTTCAACTCAACCTTCCTAAACAAACGGCAAAGCAC
                      ____________________________________________________________
consensus TGAAATTTCAGCACCCTCATCCAGCTTCAACTCAACCTTCCTAAACAAACGGCAAAGCAC
 
. : . : . : . : . : . :
JMSF028C20+ AAAAGGAGCCTGACCAGCGTGAGTTCCATCAAATTTGTTTTCAGTTGTACGATACTCATG
JMSF022K14+ AAAAGGAGCCTGACCAGCGTGAGTTCCATCAAATTTGTTTTCAGTTGTACGATACTCATG
JMFF051P06+ AGTTCCATCAAATTTGTTTTCAGTTGTACGATACTCATG
                      ____________________________________________________________
consensus AAAAGGAGCCTGACCAGCGTGAGTTCCATCAAATTTGTTTTCAGTTGTACGATACTCATG
 
. : . : . : . : . : . :
JMSF028C20+ AATCACCCAATGAGTCCTCTTCCCTTCAGGAGCTCGACCTAAGTAGTACACTAAAGTCTT
JMSF022K14+ AATCACCCAATGAGTCCTCTTCCCTTCAGGAGCTCGACCTAAGTAGTACACTAAAGTCTT
JMFF051P06+ AATCACCCAATGAGTCCTCTTCCCTTCAGGAGCTCGACCTAAGTAGTACACTAAAGTCTT
                      ____________________________________________________________
consensus AATCACCCAATGAGTCCTCTTCCCTTCAGGAGCTCGACCTAAGTAGTACACTAAAGTCTT
 
. : . : . : . : . : . :
JMSF028C20+ TTTCATCCCAACCTTTGCACCCTTCCTCGACGAAATGGTCCTATCTTTGCCAGTTGCCTT
JMSF022K14+ TTTCATCCCAACCTTTGCACCCTTCCTCGACGAAATGGTCCTATCTTTGCCAGTTGCCTT
JMFF051P06+ TTTCATCCCAACCTTTGCACCCTTCCTCGACGAAATGGTCCTATCTTTGCCAGTTGCCTT
JMSF012A13+ GCCAGTTGCCTT
JMFF044N07+ ATCCCAACCTTTGCACCCTTCCTCGACGAAATGGTCCTATCTTTGCCAGTTGCCTT
JMSF031H11+ ACGAAATGGTCCTATCTTTACCAGTTGCCTT
                      ____________________________________________________________
consensus TTTCATCCCAACCTTTGCACCCTTCCTCGACGAAATGGTCCTATCTTTGCCAGTTGCCTT
 
. : . : . : . : . : . :
JMSF028C20+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTG
JMSF022K14+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
JMFF051P06+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
JMSF012A13+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
JMFF044N07+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
JMSF031H11+ CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
                      ____________________________________________________________
consensus CCAGTACCCTCGCTCTGTTGCACGATTCAACCTCTGCCCATTCTGATACTTGCGATCTTT
 
. : . : . : . : . : . :
JMSF022K14+ TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
JMFF051P06+ TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
JMSF012A13+ TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
JMFF044N07+ TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
JMSF031H11+ TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
                      ____________________________________________________________
consensus TGGGCAGAAGAAGAACCATTCATTGTCATGTGATTCTACAAATGACATATCGGGCAAATC
 
. : . : . : . : . : . :
JMSF022K14+ CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
JMFF051P06+ CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
JMSF012A13+ CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
JMFF044N07+ CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
JMSF031H11+ CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
                      ____________________________________________________________
consensus CCAGGGCTCATGCTTACAGATATCAACTTCGCGAATAACACTAACTTCTGCTTCCGAACC
 
. : . : . : . : . : . :
JMSF022K14+ GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
JMFF051P06+ GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
JMSF012A13+ GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
JMSF018B18+ ATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
JMFF044N07+ GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
JMSF031H11+ GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
                      ____________________________________________________________
consensus GGTGATCTTCATCTTCAAATAGTGATCCACCAGCTCCTCGTCAGTCGGCCGGAACCGGTA
 
. : . : . : . : . : . :
JMSF022K14+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
JMFF051P06+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
JMSF012A13+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
JMSF018B18+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
JMFF044N07+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
JMSF031H11+ CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
                      ____________________________________________________________
consensus CCCCACCGGCAGCGAGTGCAGGGGTGGTAACCCCGTCGGCCTTTCCACCTTTAGTACAGC
 
. : . : . : . : . : . :
JMSF022K14+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
JMFF051P06+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
JMSF012A13+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
JMSF018B18+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
JMFF044N07+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
JMSF031H11+ CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
                      ____________________________________________________________
consensus CATCTCCACGCCGCAAAGTTCACAGAGAGAGAGAAAGAGAGAGGGTGGGAGAGATATACG
 
. : . : . : . : . : . :
JMSF022K14+ TATGTGC
JMFF051P06+ TATGTGCCTGCCTGTATTTTTCAAAAGAAAAACAGAGATAAA
JMSF012A13+ TATGTGC
JMSF018B18+ TATGTGCCTGCCTGTATTTTTCAAAAGAAAAACAGAGATAAAGC
JMFF044N07+ TATGTGCCTGCCTGTATTTTTCAAAAGAAAAACAGAGATAAAGCAAAAGCAAGCTGAAAA
JMSF031H11+ TATGTGCCTGCCTGTATTTTTCAAAAGAAAAACAGAGATAAAGCAAAAGCAAGCTGAAAA
                      ____________________________________________________________
consensus TATGTGCCTGCCTGTATTTTTCAAAAGAAAAACAGAGATAAAGCAAAAGCAAGCTGAAAA
 
. : . : . : . : . : . :
JMFF044N07+ GTGCGAGTATTTAAGAGGATTCTGAGAAAAGCTTTAGATCTCAATTGCAGTAAGATTCCT
JMSF031H11+ GTGCGAGTATTTAAGAGGATTCTGAGAAAAGCTTTAGATCTCAATTGCAGTAAGATTCCT
                      ____________________________________________________________
consensus GTGCGAGTATTTAAGAGGATTCTGAGAAAAGCTTTAGATCTCAATTGCAGTAAGATTCCT
 
. : . : . : . : . : . :
JMFF044N07+ GGAAAATTCATTTAGGGCTTTGAGTAGCCATGAAACTTCCACGAAACTTCTCT
JMSF031H11+ GGAAAATTCATTTAGGGCTTTGAGTAGCCATGAAACTTCCACGAAACTTCTCTGTGTTAA
                      ____________________________________________________________
consensus GGAAAATTCATTTAGGGCTTTGAGTAGCCATGAAACTTCCACGAAACTTCTCTGTGTTAA
 
. : . : . : . : . : . :
JMSF031H11+ AAATGGGGAAGAAGAAGAAGGAGAAGAGAGAAAACTGCGAAATGAATTTCAGCTGACCTC
                      ____________________________________________________________
consensus AAATGGGGAAGAAGAAGAAGGAGAAGAGAGAAAACTGCGAAATGAATTTCAGCTGACCTC