Previous Contig 006738:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022N20Sequence595006738 (7)pir|C85020|C850206e-56hypothetical protein AT4g01560 [imported] - Arabidopsis thaliana>gb:ATCHRIV4_154807006738 (7)gb:AP003526_18304617e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFS099F12Sequence627006738 (7)gb:AP003526_18304611e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMSF031H08Sequence677006738 (7)gb:AP003526_18304612e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054724006738 (7)gb:AP003526_18304614e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMSF041M20Sequence792006738 (7)pir|C85020|C850204e-44hypothetical protein AT4g01560 [imported] - Arabidopsis thaliana>gb:ATCHRIV4_154672006738 (7)gb:AP003526_18304619e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041M20- AATATAAGCCGCAACAAAACATGTGAG
rJMSF031H08- AATATAAGCCGCAACAAAACATGTGAG
rJMFF022N20- TTCTCAACTTGACTGTCAATACAAATATAAGCCGCAACAAAACATGTGAG
                      ____________________________________________________________
consensus TTCTCAACTTGACTGTCAATACAAATATAAGCCGCAACAAAACATGTGAG
 
. : . : . : . : . : . :
rJMSF041M20- CTGAATAAACTTACCGTAACAAGGAAAACATTAGCGACGACTTCTACATAATTATGCAAC
rJMSF031H08- CTGAATAAACTTACCGTAACAAGGAAAACATTAGCGACGACTTCTACATAATTATGCAAC
rJMFF022N20- CTGAATAAACTTACCGTAACAAGGAAAACATTATCGACGACTTCTACATAATTATGCAAC
                      ____________________________________________________________
consensus CTGAATAAACTTACCGTAACAAGGAAAACATTAGCGACGACTTCTACATAATTATGCAAC
 
. : . : . : . : . : . :
rJMSF041M20- AAGAATAAAGTCTAAAGATTGGTTTATGCCAGCTTGGGGCCAGGGTGTTGGGTGTATGAT
rJMSF031H08- AAGAATAAAGTCTAAAGATTGGTTTATGCCAGCTTGGGGCCAGGGTGTTGGGTGTATGAT
rJMFF022N20- AAGAATAAAGTCTAAAGATTGGTTTATGCCAGCTTGGGGCCAGGGTGTTGGGTGTATGAT
                      ____________________________________________________________
consensus AAGAATAAAGTCTAAAGATTGGTTTATGCCAGCTTGGGGCCAGGGTGTTGGGTGTATGAT
 
. : . : . : . : . : . :
rJMSF041M20- GATACTGAAACTCCATGGCAAAGCATCACAAGAAAAATCTCCGACGACTGGTATCCATCT
rJMSF031H08- GATACTGAAACTCCATGGCAAAGCATCACAAGAAAAATCTCCGACGACTGGTATCCATCT
rJMFF022N20- GATACTGAAACTCCATGGCAAAGCATCACAAGAAAAATCTCCGACGACTGGTATCCATCT
                      ____________________________________________________________
consensus GATACTGAAACTCCATGGCAAAGCATCACAAGAAAAATCTCCGACGACTGGTATCCATCT
 
. : . : . : . : . : . :
rJMSF041M20- CCGGCTTATGAACCCATTCATATTCCCCACCCTTTGTATCAAAGGTGCCATGCTGGAGGC
rJMSF031H08- CCGGCTTATGAACCCATTCATATTCCCCACCCTTTGTATCAAAGGTGCCATGCTGGAGGC
rJMFF022N20- CCGGCTTATGAACCCATTCATATTCCCCACCCTTTGTATCAAAGGTGCCATGCTGGAGGC
                      ____________________________________________________________
consensus CCGGCTTATGAACCCATTCATATTCCCCACCCTTTGTATCAAAGGTGCCATGCTGGAGGC
 
. : . : . : . : . : . :
rJMSF041M20- TAATTAATTTCAGCGTAAAACGTGGACCACATTCCTGAAGACGGGCAACAACTTTTTCCT
rJMSF031H08- TAATTAATTTCAGCGTAAAACGTGGACCACATTCCTGAAGACGGGCAACAACTTTTTCCT
rJMFF022N20- TAATTAATTTCAGCGTAAAACGTGGACCACATTCCTGAAGACGGGCAACAACTTTTTCCT
                      ____________________________________________________________
consensus TAATTAATTTCAGCGTAAAACGTGGACCACATTCCTGAAGACGGGCAACAACTTTTTCCT
 
. : . : . : . : . : . :
rJMSF041M20- GGGGGTTAGTCTGGTCCTCATTCTCTTTGCCTTTTTTCCCTTGTGAGTCCTGTTTGCCTT
rJMSF031H08- GGGGGTTAGTCTGGTCCTCATTCTCTTTGCCTTTTTTCCCTTGTGAGTCCTGTTTGCCTT
rJMFF022N20- GGGGGTTAGTCTGGTCCTCATTCTCTCTGCCTTTTTTCCCTTGTGAGTCCTGTTTGCCTT
                      ____________________________________________________________
consensus GGGGGTTAGTCTGGTCCTCATTCTCTTTGCCTTTTTTCCCTTGTGAGTCCTGTTTGCCTT
 
. : . : . : . : . : . :
rJMSF041M20- GCTTTGTCTCAAATATATAACGATGATGGCGGAAAAAAATAAAATCACGCTGGTTGTGAA
rJMSF031H08- GCTTTGTCTCAAATATATAACGATGATGGCGGAAAAAAATAAAATCACGCTGGTTGTGAA
rJMFF022N20- GCTTTGTCTCAAATATATAACGATGATGGCGGAAAAAAATAAAATCACGCTGGTTGTGAA
                      ____________________________________________________________
consensus GCTTTGTCTCAAATATATAACGATGATGGCGGAAAAAAATAAAATCACGCTGGTTGTGAA
 
. : . : . : . : . : . :
rJMSF041M20- ATGTTACAACTCTCCGGCCTTTGAAATTGGGATCTTGTGGAAAAAGTGCTTGAATCATCC
rJMSF031H08- ATGTTACAACTCTCCGGCCTTTGAAATTGGGATCTTGTGGAAAAAGTGCTTGAATCATCC
rJMFF022N20- ATGTTACAACTCTCCGGCCTTTGAAATTGGGATCTTGTGGAAAAAGTGCTTGAATCATCC
                      ____________________________________________________________
consensus ATGTTACAACTCTCCGGCCTTTGAAATTGGGATCTTGTGGAAAAAGTGCTTGAATCATCC
 
. : . : . : . : . : . :
rJMSF041M20- TCCCTATTCGATGCCCCAAACGCGTAGTGAAGTTGGCCAAAACTAGCTCTGGTATGTGAC
rJMSF031H08- TCCCTATTCGATGCCCCAAACGCGTAGTGAAGTTGGCCAAAACTAGCTCTGGTATGTGAC
rJMFF022N20- TCCCTATTCGATGCCCCAAACGCGTAGTGAAGTTGGCCAAAACTAGCTCTGGTATGTGAC
                      ____________________________________________________________
consensus TCCCTATTCGATGCCCCAAACGCGTAGTGAAGTTGGCCAAAACTAGCTCTGGTATGTGAC
 
. : . : . : . : . : . :
rJMSF041M20- TAGTTGGA-TTNCATGATTCTTGAGATCCTTCCGTAGGACANGTCTGGAGAGCTT-AAAT
rJMSF031H08- TAGTTGGATTTCCATGATTCTTGAGATCCTTCCGTAGGACAAGTCTTGAGAGCTTAAAAT
rJMFF022N20- TAGTTGGATTTCCATGATTCTTGAGATCCTTCCGTAGGACAAGTCTTGAGAGCTTAAAAT
JMFF022N20+ AAAT
                      ____________________________________________________________
consensus TAGTTGGATTTCCATGATTCTTGAGATCCTTCCGTAGGACAAGTCTTGAGAGCTTAAAAT
 
. : . : . : . : . : . :
rJMSF041M20- GAGCTGTAGGACCATCAGGTAGCCCTATGATGAGTAGAGCATCTGGT
rJMSF031H08- GAGCTGTAGGACCATCAGGTAGCCCTATGATGAGTAGAGCATCTGGTTCCCAACGATTAG
rJMFF022N20- GAGCTGTAGGACCATCAGGTAGCCCTATGATGAGTAGAGCATCTGGTTCCCAACGATTAG
JMFF022N20+ GAGCTGTAGGACCATCAGGTAGCCCTATGATGAGTAGAGCATCTGGTTCCCAACGATTAG
JMSF041M20+ CCCAACGATTAG
                      ____________________________________________________________
consensus GAGCTGTAGGACCATCAGGTAGCCCTATGATGAGTAGAGCATCTGGTTCCCAACGATTAG
 
. : . : . : . : . : . :
rJMSF031H08- TGTGTACNACGATAATGGAAGTAAAATCCCTTCCTTT
rJMFF022N20- TGTGTACAACGATAATGGAAGTAAAATCCCTTCCTTTTGCATATTCNACAATCTTTTTTA
JMFF022N20+ TGTGTACAACGATAATGGAAGTAAAATCCCTTCCTTTTGCATATTCAACAATCTTTTTTA
JMSF041M20+ TGTGTACAACGATAATGGAAGTAAAATCCCTTCCTTTTGCATATTCAACAATCTTTTTTA
                      ____________________________________________________________
consensus TGTGTACAACGATAATGGAAGTAAAATCCCTTCCTTTTGCATATTCAACAATCTTTTTTA
 
. : . : . : . : . : . :
rJMFF022N20- NGTCATATGTCCCTCCCTTGTAGTAGTGAGCATTAGG
JMFF022N20+ GGTCATATGTCCCTCGCTTGTAGTAGTGAGCATTAGGAATAACAGAGAGCAATTCAGTAA
JMSF041M20+ GGTCATATGTCCCTCGCTTGTAGTAGTGAGCATTAGGAATAACAGAGAGCAATTCAGTAA
JMFS099F12+ CAATTCAGTAA
JMSF031H08+ CAATTCAGTAA
                      ____________________________________________________________
consensus GGTCATATGTCCCTCGCTTGTAGTAGTGAGCATTAGGAATAACAGAGAGCAATTCAGTAA
 
. : . : . : . : . : . :
JMFF022N20+ TAAATGCAGGCCCCCTTGTGGATTTCAACCGGGACGTTGTGATCAAAATCTTAGGAACTT
JMSF041M20+ TAAATGCAGGCCCCCTTGTGGATTTCAACCGGGACGTTGTGATCAAAATCTTAGGAACTT
JMFS099F12+ TAAATGCAGGCCCCCTTGTGGATTTCAACCGGGACGTTGTGATCAAAATCTTAGGAACTT
JMSF031H08+ TAAATGCAGGCCCCCTTGTGGATTTCAACCGGGACGTTGTGATCAAAATCTTAGGAACTT
                      ____________________________________________________________
consensus TAAATGCAGGCCCCCTTGTGGATTTCAACCGGGACGTTGTGATCAAAATCTTAGGAACTT
 
. : . : . : . : . : . :
JMFF022N20+ GGTCTTTCCTGAGTACAGCACTAAATTCATCCACATCATTGCTAGCAAAGAGCTCTTCAT
JMSF041M20+ GGTCTTTCCTGAGTACAGCACTAAATTCATCCACATCATTGCTAGCAAAGAGCTCTTCAT
JMFS099F12+ GGTCTTTCCTGAGTACAGCACTAAATTCATCCACATCATTGCTAGCAAAGAGCTCTTCAT
JMSF031H08+ GGTCTTTCCTGAGTACAGCACTAAATTCATCCACATCATTGCTAGCAAAGAGCTCTTCAT
                      ____________________________________________________________
consensus GGTCTTTCCTGAGTACAGCACTAAATTCATCCACATCATTGCTAGCAAAGAGCTCTTCAT
 
. : . : . : . : . : . :
JMFF022N20+ CATCAGGTTTGCAGACAGTCTCATCAGCCTCCCTGGTATTCTCTATAGTGCGGGGGATCT
JMSF041M20+ CATCAGGTTTGCAGACAGTCTCATCAGCCTCCCTGGTATTCTCTATAGTGCGGGGGATCT
JMFS099F12+ CATCAGGTTTGCAGACAGTCTCATCAGCCTCCCTGGTATTCTCTATAGTGCGGGGGATCT
JMSF031H08+ CATCAGGTTTGCAGACAGTCTCATCAGCCTCCCTGGTATTCTCTATAGTGCGGGGGATCT
                      ____________________________________________________________
consensus CATCAGGTTTGCAGACAGTCTCATCAGCCTCCCTGGTATTCTCTATAGTGCGGGGGATCT
 
. : . : . : . : . : . :
JMFF022N20+ TCTTAGGAGGAAGCTCTTCACCGAGCTCCAGAGCCCTTTTTTCAGCAGCTTCGCGGGCTT
JMSF041M20+ TCTTAGGAGGAAGCTCTTCACCGAGCTCCAGAGCCCTTTTTTCAGCAGCTTCGCGGGCTT
JMFS099F12+ TCTTAGGAGGAAGCTCTTCACCGAGGTCCAGAGCCCTTTTTTCAGCAGCTTCGCGGGCTT
JMSF031H08+ TCTTAGGAGGAAGCTCTTCACCGAGCTCCAGAGCCCTTTTTTCAGCAGCTTCGCGGGCTT
                      ____________________________________________________________
consensus TCTTAGGAGGAAGCTCTTCACCGAGCTCCAGAGCCCTTTTTTCAGCAGCTTCGCGGGCTT
 
. : . : . : . : . : . :
JMFF022N20+ TAGCCTTCTTGCGCTTGTCTAGCTTCTTCTCCTGCTTGAGCTTCGCATGGACAGCAGATC
JMSF041M20+ TAGCCTTCTTGCGCTTGTCTAGCTTCTTCTCCTGCTTGAGCTTCGCATGGACAGCAGATC
JMFS099F12+ TAGCCTTCTTGCGCTTGTCTAGCTTCTTCTCCTGCTTGAGCTTCGCATGGACAGCAGATC
JMSF031H08+ TAGCCTTCTTGCGCTTGTCTAGCTTCTTCTCCTGCTTGAGCTTCGCATGGACAGCAGATC
                      ____________________________________________________________
consensus TAGCCTTCTTGCGCTTGTCTAGCTTCTTCTCCTGCTTGAGCTTCGCATGGACAGCAGATC
 
. : . : . : . : . : . :
JMFF022N20+ TTTTTTCCTTGTTCTTTATCGAGGATGGCAGCAGAGTTTCCCTCGTGTTTTGGTTCTCTC
JMSF041M20+ TTTTTTCCTTGTTCTTTATCGAGGATGGCAGCAGAGTTTCCCTCGTGTTTTGGTTCTCTC
JMFS099F12+ TTTTTTCCTTGTTCTTTATCGAGGATGGCAGCAGAGTTTCCCTCGTGTTTTGGTTATCTC
JMSF031H08+ TTTTTTCCTTGTTCTTTATCGAGGATGGCAGCAGAGTTTCCCTCGTGTTTTGGTTCTCTC
                      ____________________________________________________________
consensus TTTTTTCCTTGTTCTTTATCGAGGATGGCAGCAGAGTTTCCCTCGTGTTTTGGTTCTCTC
 
. : . : . : . : . : . :
JMFF022N20+ TTTTGGTATCAATGGAAGTGCTAGCTTCTCCGTCGTCCCCCTTATC
JMSF041M20+ TTTTGGTATCAATGGAAGTGCTAGCTTCTCCGTCGTCCCCCTTATCGCCGCCATTGTTCT
JMFS099F12+ TTTTGGTATCAATGGAAGTGCTAGCTTCTCCGTCGTCCCCCTTATCGCCGCCATTGTTCT
JMSF031H08+ TTTTGGTATCAATGGAAGTGCTAGCTTCTCCGTCGTCCCCCTTATCGCCGCCATTGTTCT
                      ____________________________________________________________
consensus TTTTGGTATCAATGGAAGTGCTAGCTTCTCCGTCGTCCCCCTTATCGCCGCCATTGTTCT
 
. : . : . : . : . : . :
JMSF041M20+ TCCTCCGTTTTTCCCCCATTGGAGTAGAGTTTAGCTAACTGCTGTGCGGGGAAAACTTAT
JMFS099F12+ TCCTCCGTTTTTCCCCCATTGGAGTAGAGTTTAGCTAACTGCTGTGCGGGGAAAACTTAT
JMSF031H08+ TCCTCCGTTTTTCCCCCATTGGAGTAGAGTTTAGCTAACTGCTGTGCGGGGAAAACTTAT
                      ____________________________________________________________
consensus TCCTCCGTTTTTCCCCCATTGGAGTAGAGTTTAGCTAACTGCTGTGCGGGGAAAACTTAT
 
. : . : . : . : . : . :
JMSF041M20+ TAGGGATTTGAAATTGAAGGTTTGTCTACGAATCGGACCTTATCGCCTTGTCGGGCGCCG
JMFS099F12+ TAGGGATTTGAAATTGAAGGTTTGTCTACGAATCGGACCTTATCGCCTTGTCGGGCGCCG
JMSF031H08+ TAGGGATTTGAAATTGAAGGTTTGTCTACGAATCGGACCTTATCGCCTTGTCGGGCGCCG
                      ____________________________________________________________
consensus TAGGGATTTGAAATTGAAGGTTTGTCTACGAATCGGACCTTATCGCCTTGTCGGGCGCCG
 
. : . : . : . : . : . :
JMSF041M20+ CCGTCGAGTTCGGTAATGGCGGTAGGCCGTCGCTATGAGTTTATGACTGAATGAAGAATT
JMFS099F12+ CCGTCGAGTTCGGTAATGGCGGTAGGCCGTCGCTATGAGTTTATGACTGAATGAAGAATT
JMSF031H08+ CCGTCGAGTTCGGTAATGGCGGTAGGCCGTCGCTATGAGTTTATGACTGAATGAAGAATT
                      ____________________________________________________________
consensus CCGTCGAGTTCGGTAATGGCGGTAGGCCGTCGCTATGAGTTTATGACTGAATGAAGAATT
 
. : . : . : . : . : . :
JMSF041M20+ GAAGATGGACAAGGGAGTGAGGCAACGTCAAGGAATTATGAATTTAGGAACTAGGGTTTC
JMFS099F12+ GAAGATGGACAAGGGA
JMSF031H08+ GAAGATGGACAAGGGAGTGAGGCAACGTCAAGGAATTATGAATTTAGGAACTAGGGTTTC
                      ____________________________________________________________
consensus GAAGATGGACAAGGGAGTGAGGCAACGTCAAGGAATTATGAATTTAGGAACTAGGGTTTC